%PDF-1.3 3 0 obj <> endobj 4 0 obj <> stream xN0ʹf cqS#$`'19RmJ{:X:U; W0 XGik6~Syn.ox΃Y,tAXRn̰??p? =G2c5y| endstream endobj 5 0 obj <> endobj 6 0 obj <> stream x퓽 A })p/^l+X)"W{Z\cLT#88ڠwj`DH7lRv([w:pu"rUY'9S XWVfc&\Op'``$?JV:ZdOLYɨ+fRs;G>q endstream endobj 7 0 obj <> endobj 8 0 obj <> stream x3R235W(r Qw3T0430PISp \`:P"Tldgl`a`ghԦjLh~U0PHQ[8,1FA !S= PCXFXQP endstream endobj 9 0 obj <> endobj 10 0 obj <> stream x퓽 1<ŔZfMҊ?h'+A{}BcYfq8ЛUFe0["68Txgxح9AR.,+% hSR/B@wX?q~ &Fz:HGo;E\Tcot|/#^7Tސ endstream endobj 11 0 obj <> endobj 12 0 obj <> stream x3R235W(r Qw3T0430PISp \`:P"Tldgl`a`ghԦjLh~U0PHQ[Eք3h^p)X",b,z`bQS}SDbIt endstream endobj 1 0 obj <> endobj 13 0 obj <> endobj 14 0 obj <> endobj 15 0 obj <> endobj 16 0 obj <> stream ,Photoshop 3.08BIM}ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw $}ICC_PROFILE{od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B}ICC_PROFILE3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQ}ICC_PROFILEDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKl}ICC_PROFILELnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 }ICC_PROFILE E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ }ICC_PROFILE K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:}ICC_PROFILE 7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_ki}ICC_PROFILE kvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht}ICC_PROFILE ! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: }ICC_PROFILEuGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhw}ICC_PROFILEgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=}ICC_PROFILEN=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dh}ICC_PROFILEjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<}ICC_PROFILE|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~}ICC_PROFILE !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$_v`"e&xG16 \1Zn,AP}JHlcd2 bG䆔Gq~8io8mS +ST Mw톢zbDeӄrC6k-;f(k{=m[vn}bGE@ ](i1s֭u j{{L#u޽*enEE+¹C#:Jj\PRKoCJ{{dJJcqr[GYAZmjS:Pl?mO0Vj>>9.YHd-ʝhiPoL\,CBj>T7cTH2C>lx| 7N4Ej:f.iV`¼p S09K{o)%NN.ְ%=:dIV͜!.& q[iYQ!lY*9 Z7;Öن yk5w՛\xxP6':XO RMlǏv~Ҿ[/cPEoN6q =FĶhmvo -F,lצ┨ʜ߯lny Rw^|zli_ˉ(jd5jSuB{cE_NoAO=C"i+_ͻ)ǚl?|]| HspVLf1^A}>|Il.{azȊWs;6O#m{o6qa򬅠08f9rd/ߧ_LVJPd1Y)Rw|1BL5}>.(JSmJf#m %7yαCr>xu)ot:]L/|Գ/MNaNCnXX”]3h| ʘqqwӘ?.Z>5sQmt΄k_h=8mhJNdD[2dIJ@Pl[]5Ls#XӢ.jFʘg9bw$Rk61ƄaS)tHX(bsQsg>t1E>pQF5عwU 3L~olԊO;hMX6 ;̊wZFX,h`WZo2mOmCRkm\FKD??eFL N-5)Byl,M(taDO\QLPvA?%Q!=촮Яk܏ʇ]+PI4򂻝Ma!I)RG3 хu*a =rXGn?ӑ|V%Þ#ׅ@~*kP_ţWu۩ƙ2([JRA_*qcH^D{dyȔE$劊BvLrӆ#cLRm\AH* jO+]ĕ%CPP?=z„wO G6ъZ`FsZl;,2aSj*Z{鋪PS"PPTTװ?`A߯BG&}ǧxM8־#Ps&o$ڵq* 6džUhR`kSvҬ$oV}_nŝM3b {n~ၜZbvT5+o~جgn MP+P>L|*%\A;o_pp3A~8:))#Aq*= ?6J`P_^Bhw;ᖶlk)qԖ)ZƵ6zsZ$wA1dD)BFYJݾX.=7 J vv~LQ(B߮ ԩ>5Lҝ vF1k@4@~xTxoTh p#]z..8(:i( BV4{={IJ6;>[Ҵ_,E~-QBJ 9~bjS@}q!PEOՁYR064="|Fz&{dЩƾޘRQķ i;zb]C$zV~0R*v|"Ld,$:͸6Lʐw͖,u8,aiLNxBh;:%fc|HRɵC*Ezu0ds%ytb6 ~]R+3/yC!HkVMb] A] 0M+vUK[. #*Qۦǧ&Vwŀ3B瘼;2TVy(߾kt'o,}䵢\- ᅥavQo@ "1hH;NgŚ}\M;H}} t޻e}ιIsP44W}`YZ +Jn i?Tҙ v-T*a.;jfd׍*3e ٩G|7A܃IcKeͩ^smԒEv?FX+8iH@;ԏ\R4E=LJZQb( >gJЯBˈ6+ SZ541V9E+?'4rd;COȕߛYjDg8SԳ7YʯH=L_o! yxǡ~P*D9ŹzWo #mt9@amBa@" NK Fc `Q„ G[BG*{w 'z^$ G.TO9j+<Cv}Mm?!׶X A+ZCJ_<}2-j۷%n)ߥ:<5Ȃh@#mqƷ{< I*ԩ\:Nhm%%OX"PEFs@ŻӮdD[>:}/ym"O(ڀb f;Tq[-E%H]Bh;p FY8)O8OsCoކ/06]*&)&ox#&#q#sg%:ljۚZPқ55kQv:z@>tP@@rV6RIGu(t#rYaZREHRHۥ*?JH' b:NޕNdf4ny̯(d'ؓ,RqM6>BIs P|KRj7o\/̓Ԋ TWsk Va(sP6DjJc#)t!'P--oedem4v5ql vjQӾ YoǧӅҵ(~ 7>atSq3MRϿn(GGJ>_&𠦑UJç݅v#&:vLӦKɶݎ\ńA&\c}4ll8c4 TTT!RScJWl*Zj>`UN8| 25buvʭ %߉)4 $*jMEqt #PⅅkU5 E*w6%HFF;t8Pⶭ*v9ъ>;u;eʧZ<~XzȒ)Py1wcOzJ]#Ah`U`_:8Q⸥dR( qnHϮaMeGjoE+-9&#z} E;82kֵB+UJOcr$Wl*qW`{*Vj()NI?2r)U9 wĚQĊzeU Rj@>9$|r{xz(M0m_lE? im+?"6=cd'xwR*v2Eġ7cA}G$I]ޘ0_~{b%lU\-wc`A;VuZTl|)}%4㡮˷N>8.Ҫn؛%>_ QKjOA;m,TVZ|i7qnٶY+|:l+BN8QN(Im O@QS~~7Ѯ%ՒA~qE2`+]gRAl^?o2|+j$uI-mr7tk&nޞͲ1zq((#w6Iɍ {fGjwŭ,nLH6QuYJ7M4r`k_:ECN"J3)ĵELS~'VӘ34\xUƤ~ʀE |rDjNךlbC0X ᭭nۜ1hÂ׷ J b|3<aSӯI:½zi|O6[Y9IP*@=jI|\j`ߧLz&()RH ]>Z6*> i^jv)3̇_ۨjSO~d$E1cj8f5Zu풫 62kw!;}ORaV!y 8z`u;!w@g{EKJM(~])$N[VtШUX֔J֕"oVƕvrr}KA%|U&GQiwӯtcyFqqUkE弃 /YV*OlHRȃn16pi("jS> ~=rcwE/xGes j 溕Ϩ]ARzz$6 @|ͬ*ڭ4zLS2\$̗B> O4봴PI?|g)XIʫS ټ{Z@\䤊O(FZt 1%kY LHi@Ci!WIQʽwQd})P$iZfcS3dV`Hxq_7F0eJ[ZN:֣U?dD[˕E.'?z)m#!NB+9;ЎHg Ŝx\a7/nJjAlYDc*c0 Vɶ}M:O%@샅P)-|IlM)q[H(MR>-zbOM%:l3nVJoRkAiI]QOllSl@y+B.ԠByôUқa81k4kȭ'ކ.kQOߘE-{|" rrz{ȐփU n{s"X8"Gfd=$67iGkTExd8֣¹d:dHA  e4ݼ@\/f 䒚8>>'ZWnAu„doF0!)q"ᇶ7GO釉Q)C6ң5XxcSSӂtbF6Y%jU@ 0ZPqd ֝X-TJ6~efIJ盗CO\1XꢹY6ij  GOUV"| S`BE5BH  e9_[=E;%$o i~8\;6L-qq܇q! b(3<2)UU__+g&ړ('|)d O  _'y(VHE}>T}Ob7:*)(:@v5tg%b2lx Xր| `0*k3'=XTbڏ;nGO2-ۊue"qUu&wR4A=jF~"f^ۚ { MqUucJjo㕋oSLUk`$}*jV {` CO4;@iN@]mҕ)ZtdxsMv +QCOH#bBZ~8+_ c@iNL4I#0EHo-Rm9 eWSqOHhH>EPT)޾9T&_nxkRUpv0M*$ҟea@+8`Nb:Sz 'k׭vq& (xmқ`F-EZo_ׁ ҢXCփ U*q/*iካiJb?VEF ZnEkwQv]o-w̼wW6gmM(oad* \Te %Nzz"-[|q р(<(|q'A=6F0?k5ڴ]bҒ*oʐs]wL5΢ᇍ,P֏>AS{l-۶cDyǘ5H">CɠZEAS&`VgFjh.?|ioqq}dT]%B!A<*o|鄩l^k氳!Z҇m r}lLri|ǭNCaR4'ϾC3Sꁻ iQހ,pt-ׂYAI5>9A Xrp&~(+r+,dLfEVhal$w RGQŽl4fFLߎ4Y1qE+p @ .%"4xX{|rʲN2Qы"ץ w`ql+۶ j;TzP6 ֻY?L,vdcu@h),ֵpq8\/Ixvًn8TAQ A|wʌ-'ՙ#|&_+\iv1rsyN(zVzdM{eڧ4-քF%y,1'%NíjM"q,gdXqAz·%S`ލܘʙ)CM؏ <;2 PG0ӭ{dKq )1=oC%Z}0Cm,)̎W77>`~SU )׾Vg)3$kγ; Ͼ@9m`q ;^BڭNSそɕb u? 4f9Q :r\(%~U7֝*㑐\L.%ACmu9S+E,EƊ81~+ĩFEuNg~D|&zt 402֤T(cJ+j/-}3NE`7p71[GG:S5:!L@ O"mW M6IVa_H#~ JNTehQ2݂Nk`A)tQ0ZP\﹧*n;aT:_퀫EE+N➝G 7ёZkաvC|1U#hXϷ>|TĎPkVhztahJ~ [BhrNS Hzn9jVbՠ5jd {Ob~$,w*} ^ǷJ*sB`W);W8ȦzdZD_lOL^bZjB7'޽|pYJ}i(<)dB^!E}=p )mSEH;ֿN6z{E ii|M(EnE#bFOAQiv+RX LEC:;hO|4&AZޝ+P -lCc넕J@ymvBecHƛ7\[D${u~[afH]8~(?Pnz[rc9vI_#s>`:षB>61&M0-Q#n)rL GN!(>8&>eZCczOו izG^ہjw0%>KWߠS;jx`).WB2;~?+!ݰݑQo|!atJDUU!1׿l Hnt=DjW%$m|ВeJlu3QA9HQ~ɦVEj҃mQ!#t<Xҥ:F L5!ranԭv4߯ʝջD2;g`Irv;S@itǡ^LO݃o#1avˢۏAW:eJ隙.TMh}]*AdK:ykZ7io5.:t<br^v 6=Z\`0t7jXߞi 74'gKmqlw<~vyU[獘~mc1.ZSD~ڵIC]Ȇh&SV֧tj;9x,x؞b&>āPMAXoĚlg1 TN&p S:B_cҝ׷L$[cJV<bEGH5z_ʢ4#xs5կG"waˣm,JMhxdh-/PHRh7<@|N&<03jSXJW|.6;ma2"0gj:ʭ@j:-"zʛT>!Mxm fH#Rma(i_" HR̖@kNӆ2ҧ- %jzr?1_ #f.bM֖JE<o ޔx1c~]^MOZR,3d"#piBz|;ur!n@= 9⍕M'#:F@r͡yB ::t9,.h67p4 9m\mL.-hzmxtrEv>H]ooi_"թ+;VӀ6|_l1ُ9pҽ݆ WjJ>yBKJ**lB[JBMi֛q*ڞ&2y P|ѥO6ĕ=x?&Z@Ȁt9 8&?.:l_+|^)Gù-₟c[~}()@{jU"&VFWUf#|h޵U>q@mzt M*'q\HIUAҿF V":Wl #w%O\Ϳ_`b.z<+mxMF/?O%]bQ| $܋0{}ݰ@>9%EӠp,YZ`V қh*){!P)`y@|FV~Xn8æLV߾MKH=Ƙy7uZx|+V:&QW~)hʞgbsAOG^3q%*zs ˠ 8Z֠ ؎ǒeab>:,%b pe Aڔ\0z8lA1~Խ;C\>^fQ `Fxuڸq THzŏ%J?)sꈎh^/1i)?d)8 `V[L&ϼ9E>cN? 'Ǹty:y~YoOLR~UxW+q5mMbT z0{2φn_Jkֻ4iaOO]LS|)!'{}<k\V0IT|Y*q& MG #oqUm&O~l~m(]nHGI܊ sH ,dH\5F3ٴ}F0mkݟQ_c~2iJ?) /jxӦAl $*h9u Sew?r *77۾ KK!H1cZ NL aUIxHg>YT+҂/D5>9e,gE Tژ];ɸef p~ƣ$R0 w 9I~ze$qnj|@DNdhԡyfrwo$O;7gB[tf8{liZu~uvIYw!AgI=D֔ ǐ0[ cyM~4S}8se |Zy!Կq!@Wk?Nu >,$|ϭ.EyPS!aԄvnXwp26_}Dm=/&b|ߜ?ZWp)Ox<ف zm  d㖚 aڦۑJۜe``^Ss]>Y"OSd!LUdZJPv9!zwcrsbhlAȖl˰hy=hqOsF/[~~Pw PAQCLЏ}d a N3]Z#E&%붗.r`GiׄS0CJdmi\Q\iaCUugĻ֝G݊ٶ|1Jo^W犭1Rw+كopi@$&v; **HcaPNf%?*=6!Ĕ;{;*I*XOSW%@(:x |-) 5!Jxw60*~8*?i) Z<lҴ?Ϯ8tUzʵ1]QaQb(j)V}&ZlqB(Db$vF4R,49j<=bç^e:C#zk]JWp ddģa|pw $%I@Ie,xKZ]?PAr!C]+p*ԧyW&om7ѰQo7П u5?Go u85~;ִ84 *:LS*ǡ}:8 #Qɥ; GwMIV'ա8"AٔC@7؎MtD!-u'Ě@)_WXX2JUmJvLL˿P? 񧿎_>[U,t$0,"I4d4=M>PJi TlF#Cݺ栧xkƐG `+~m1M/N84KJCd?c]5ʼw;d5 q? HmָR%xuڕ;o$v&HHIqZ UY:j :u8^UQ 0+U':q(*J WfuJݝ+G,lp_>uaw":UF6R=&_#jq¤ZlH;W'7d~cK }v` ;Wgak)%o=EbOHf HH]J 5h3xNtnePHTlGa.dL4M w4^!HN~6q:,V _zn~CD.L ~<1t =A>Sv4Od!Ob@-\aY\M2gi0esu.Н0XZxTbM Z TVs \۳W8)QwMjߕ4Ơ~~Y2q4ֻuңPWl7C-h{xfV'PVP7 `Sʝ(?V"Gzpm;b,vqUecM1 TLVc#î$(H.fFASL8؞1dhԚ熐Hߦ+7CVcn\Y2vO|2ԍ*J ƛֻl|6S1WzUשQzWu#+qT, i\*k@߿S0 \E}SBZP:Ҙƃ ҂OXzR{:aJk^+,Ak 5=2h~^E"٪?X^4]$ 0傘D'!%[ i) o,@ʂY( d S𝛱ъӶԦBл٪{ o̥aBkM ڻUQSCƃljQ-<*v19oUx'QP!2RTQ{XJSR- l@Vg<44q[Kָ#M.C"M*"+rf"jeڻl==o_)[l` 2%ix܏ah6SoƸE.=X4G1 <|1Qk7^šZ&{AG(^dAS&%Q&_:70wN˱z8U&1ZVJw^R:`YXՒEbR)M؁@kJE"j|F$ȵ5c P 3bQq3)_6KJ) qB)k@;`WrLUVH03޿Ue^cSޤR hv{55)9W|\ \ SmWL'6ng+D3ICZ֣N%ȁF`sZVvj6tSj+T@2|,kށkL.\vY?[Pw45Ǯ׼u5ݲ]eJ&9BH8l^W}pMPx\`RvS޹pvx#wga Fބ׿A∙>2rdL^I9l`/|-jmy=5iMi LK|o l•?ȭʘ+ ΗDSڞ;dZK-y)#m_ICdq<}QX ^?|?.[Nn8Vo o$5;bx)*)n}@k_[^eKGPlzzmNt>=" df3w+EIK@l6od˙i`v=7\iz{HA"(r2 |2"H0%SѝOb ٬&؇OqɘɴPبyzP h9k);dgYr*6}>mvf>^<ӕb>soY9|䢒Cg"o1$͎8,r0Ffކ2%u0 3(b^y|{~]rpy6[L*9j۷I{Y7^cKż#4RI  8YdCF c%9Q I/ˊQSC)2mܵj3YӼy3.J8!ˌm~];aǾ2VsK/l4DT GhW cMl?3 {j3h?DDTiuo^z{vR$klJ'^niEcƷ`eGEl"0P\ oZזYjx6[c[yI\\H+ZeVsҌ78Rv LM6X+)hqv[K"I"7TiOcj{bpl00өN8om#~j(hiʕ+4#qVxjAUm=0*Au?`m>Tx⅀oՈ J$zUgƔ##mi^6;WƷJ @O '*Ƃ@KdӊՀ#»c[ 1T*HZqAd*}b2:NM***NlUbk!%}ϾX|$;IʡSjHuݡ~jծE4&Kmjlzڛ̢X*$P;׾gTPQ&MM+Nw[6M8p锍Pme}gjyo_YYáYj{vʒCi\Z UڢV|mS.ԦԦ2BzMe޴pjJm 4ZZo+clnIn,vx@)߯LIM-3T֧3J}9&% _15 WqAD*k\Ant*oFEG;ָҹ WM/qO|4UcA뛊6.]GxZ{z~eG|TvXQ`%D\h 3p4tf|0pە 48Qjyר5_EY me+I G%4>=2G,kO0yni֞ޘa8_*yYnrwLZJ@?~S!lVHm퇋%Ԑ(>8"3jTHҝr!Z}lzk"vdWegi6?l>d,k<8}7~P` mRc{־ُ867!zGĚl) W'L3.CÈJTW-N͒љhi5QY%=?fa̤ӿx+~BfN/u G%RDS RK Ko W$S5/Oh;F|?jVh6ڟNJRV2zS~3$sRTh7+ZP%AfN96i>.(uuƐ3kt?_CCn=GE3c2 jAMNUuMi//Wwre@iq/_̐6oG:J2ToZ>l:|sUusc)E^VBFߏfВEG|Ŗ jzI+&AxS˽IAN`%gw^ֽ+3)Tv|З!rFhz2Jb"5Q_ly2RGO%dT U/{+BjGӋc+U9;ֹ$8|4nzJ `JJSڇ~W*r;m6Q&|U|qT;t5*iw逪%+b,?4̇ Gf<~epҬK8RLיa6oǟ̵&XK2~e"6;1?wRE'|cMIxq%.MY"eSIxc|qEY?)a2huMk<~e6?_;)Q|8qEX?)oߙa6 wb?2bE/<7LZ'O5Ǹ|ǟ̷*XK3<SIxq%~e6?_yoNkÏp'teߢl7-G>H-*tE/yCl^>%.]g_9'L&5p/?o]C"emO.*_Ǘyu'kyxp_?2_+yIRX-e4G/Շ/..#}3uLVޟ?*~:}1C}8ye5}M"ָbF>ZTh=+j[XLQ3|gzj7#f`^3Ps~W6R_)i?mǎo9?n~z2Hu?6+hkti6j5O\LeKj< Shţ_c͚+19dzY{aF[=ߺmģ8-g_S Jʚ y|cYM4kw?S\_C$ih?TXy[7S G埔SI-:̼3[7SA6Lf=6̼8۫Ja(Cʣ/Iz/­oYrWTi~SyVLw]S/u\L ywo#:nc3Mvq+ {pJ<kT7 zT/*c>SGmo~fyt^qqs )$6GkڸjW?S=憓df6j\ygK·LQTGV>+rm?Q_W?S ׯV)Z,iXa(UOʏ$G|/K/0[7?SmS_?\L eGU+_VpO3zWTkk|j?V0eVqɩKH-6dyWS"?-#UGOoMFq OU_*Θ>V4_Lڧ'x-xzc;h6h.?6GI/|'֘;iwSV-Jmxoʟ$TKJڷ_5L P_/4,i`bEY?'8'CZth?V >nT 32\ES-oוӭGOL'5=o-GO(Q1ڟgjfdIBD!o:c|-LͭT3WG}hǖX@?Rbmo2d{|WT^L4ZЭ }2? (kH?;hk//e>>ZqAysMs0֘Y>nUTE?-+O+[qOpOX|31O*2~W6_-!zmqe d|;0|C~hsGV_sMqK;|C~mʡ'IZ'­4jպX?xrIo4_Z,a\a=P~Ty$tv?kT;'5co+xy\KJ)ҚexiWS kXiFW6ѪBa={+WZfћV??h?!qU1+{}cL֙HX|xyCg~ߕ4Ǐ5\Lmxyʯ$O'ݖOߙ~onjՏQC,S(?.mOG\tO_Ԙ0<k̚|!?M֑o֕hƿp;y-^?;ɿxGrqpӭCLG/o2oܾ<~e_y&M5|y8_?//o?7׏ Zg,ȵc?6oǟ̻mȵ2l^<|ǟ̭d/w_uMk<~e6#<I2>d?j?7׏%-_8L&5_?21ȵ2l^<|ǟ̻]C"eSIxc|ǟ̭c,pȥ^eQ|1>K]&ǧK2~eQ%.c,PȤǞfQ|1>KZa,0Ȥ~eQ|1>K[c,pȥ_2huMk<~eߢl7̟0?7׏;|y87̟0?7׏;|y8˿E$?)_̿0??׏_?2V__;/L:&5_?2VG<K2Ǟfj??׏;1?Zt/{/Nk俘̵O?JLcԿ: wb?2]?X )3SIxq$bΗ̻&,%?D3͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*'yNҬgn0[BM#P$qh  &sG9H'dj y,:G/dQ'#F[)M?NBy݄Y>}m-[CCCMoǏ8qBBbǜIq2#S'"̶f]vJo*1: +fǡ$|S܏HO?+!ϲi! g3Q{; wߑBgʾL?:sS\Y6C/;mUeob|~j.6 .8#+oubC~]#㌎sgu$yyW̿z4_,I:_N-.O b9mOYç e7GKaۓؚ\9<92Fi~g<8O,jWΗj~4{74V;Zlp42Xy1^{yGcOqoŸ?Qvzm#5/5o]Q,Q O]S*!^Ӗ?Mˍ|W_]&K9O}VߔPߛ嗞n]7M;2X3n"u3()$qqk϶g[~vuWrp~?{ 3 8~}s/ۇ>sjG9?5B~myDmu=FK xR׊mnh =|tՎ$dfj\Rxz:.UAd7|1 kE^_e1`XHb/Ɯ[9ohY=yXy18\Fȋƛt(b(rvqs]G̺svt?O{"jwŖ4eWxig.pZ8/TjuCMӈpQWq̹,G. Jn3˾ub>l"Ek{II.cĊ iP(jPͣ?$ l{ÿ!EdEy<98&yG5ޯ]OЍ!E!^7z^{]ꧣc< ѹOAyxq deʝ?ʛO7?]6co Muu5ͥXTb(#ffޛmCQvKCIe9"3f?8v\XiDY$cgW&'m0S\T5ToMeF"HTnJx)޵z߱ddŞqsbv$oygFQ+_Jz|>jzֻIqOX;kґ;ӒԐ9E+\ ڙ6d @q˿dó0)JU3aa8miߖ:޵wqp]zP\XH !`vZ r{s'fn(DN93\v;)=| bczshW>j|q7S[@An ؀?Kr=@z~hZ64'Ju+N~4UUvߏic]Iq"]\:VQ|1 |8i,y[޵{y/l"" kb9*7^9 :}/:|xGq5N,'x$./ca KM3#`d~vHw\r:߻>mzחu-?VӺY`q"7{nu9oDď) ?{cqHssIb#rpcJd5xgK22_1}u=Dz?wdM'㷒.I'ЩG7J74FݻQfjmfC$I#7g?^R6.ȍ/_04n|ըĭVD|+rr@^({i:,M4es+3 wTfF27]3e"g~-:G彭w}a)^fIe@XD'O%A Nzi@"$gA-//NH5{!/YfB3 `Gjc8mc~Znx^甼:oWW/N9ʯ8RN<eyq [l+@rKRk͖4 D!!@`/'.&#R@#v@3p6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثg~O4-ZKŕ̖mF󉕨{=c{Aadžg!8t/4v| I`~w;%Ň75t>_^pݷ%䅠) 0Oؽ|sv1G~˽v֜9yvrşɝ"b]|]CjPb8ZPkbx;;oOeZܒi439qxW+cb1dH$.w|[;=Om_q^uҵngNl"ۨ ?zq#8c3298R.nq垊g($" >ne!j󏿖i3 ĵp%dȂ@U\reXw.ч}:3J3-.1kr6ÃM.cP19?s[QQ,kFݬQ `P[ HZlI =ڐN(D\B8/bY:]/u_>~yX'vzoKHחq[$h,oE+og;;;KSXK2&FuDD%|X>U,c,5[] vbI_?m4xtWV[KI* 4Q&>}Wiuiy .wqia02Dt˫?ww387}*M4^ܛ絊%a$LBLjC_-7fq×N"|'2"W2A9#;.Q 1<6lzh0Ɖ9=o[}?JH;{ƕ$z&0ğr)7<,#[wܝVȡ{;98aGO3!>^׆u3u(k4^ah>7O֗eQN燃kd,qgc_?i>4[~TMk4r HU+HR)f1g8O0% Ήc].qߘ?%wI,OOs|[Y?ӳ?1Mk?<: :e~_ Ѹq,.<;r.\# ҙ~h<0u]9]=W:I]QC/o3&zv'=:<7G󶹧A%VY[p9UVI4I9{ؚ]GgL8"%r8JG v]ˏQ8sU";pɚ~`O&QHn$wGzT⪆+ۍv^Џ\"U 瑩ns'r}GoO|zo8Vʬ`e"/oovyQ<7ySia;;Rsr2<##Jjjq^:Q<$=<$ɋd"=?gwܑq+XxWf%آ?eAkOߏ?;k^?wi#AL 'fN?0@NjZ#+eh*ra]&-5_{[ZTJ'"Wz${)9c-|.@1e}-6hvv5y#Z?)-4;ͨjF; [y Hwf]<_9#!$ *[m3iˎ|q4e=Gq8dO/*B?fKh}K {(cm? ?|Kǻg5#Y (@=E{:?X~ܘsJoON?=3˟_:V:A. 6v ! O: w+Ng+z;MyWH!_7mz;ql=v-%yZ}{B$]#jO:2ՌT5~{g]ņ`e<>%;.?XǪe87? j5=bib^P}YHv.2 s=k}H~?8Gwhӓٙ3ۊD|q~Ufߞz?uo-[DZ6hvѫp P,W_L<N1> z>Mq֖2łs`{ӳg9u;>{;>ˤ{~Tߕc"XkTn-zRhRGEpua䄢OL?'Hn `~}ݜ?$NW fB-_7^seͷ? ?\?dGW?Opp\˰ZٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf] hF*?mΏk2Q=V^Ax!K(yUriV+ a=e($I10u/i0N7 9W?ÿO|57m}%ܖhh Ֆ _3OS8/mc|,<"Ge+2[ >.*{ݞ?{_!P̐ĥ/! *Ms0yp&R2? 1wN"VUU8ߝt q\Ksr(PHT@wwy aœ&Hˈ)QܗSP=Ngh$?C9~OO&awYеO߅V}VBvjaܞFOz|yqCϾgC '<2,ݱ}~}۳b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊%yw:4>\4--5fk$nE/ROS1s p<1;WWӽ:qKx~\of@/4SJ󉕸Eixq7|3,qfp&'>aGtV\Nu_E\%S,aݎQ 1K300D d$y#gnGj65n_W/yF?{U$u$dtc菢'y7z߾,y~Ii| CHu +Z @c `cj?2N1Doإϟ|yϢyRM_^k'oQ.QF=8 BbW^Ju312ȳ_'`.~gykyWҠcSsm5&bGR{w9^tŗ93?gWNQD}5w|VfRs5̼bI#)E01@{h5"!;HM];rG\Nw F 'TOC-z6p>2htabū8N)Bu\<ҖFU7Qy$y;jI;INz(ym6?Pi_nWO \N׏$ni:ydN,|w||UCWG\?5a7ۮy2鯼WMD]Kk)beb$V2uZ,ZgDԁvY `; nf[^ivI$bƬƤMI=s&Q$.NNH<ͩ05eR9EA`a&rC8ay܉d2$t}gP徣_Ocynܡ6I#!БPs/>g%2@٦3q$ȃEo]Լ{>jL7sUB/9$,E }<4#bb7%HO2MPҮ!Ȍ:2A 1(1"1hdo=jvP[7HyL{Kc!lÇ #NY'v6'h6T]My\H.Ii ܹbI-Zqx|1CUW2Kٻ :I/2zk!u;SNKqKx{rv^2y[[دXo/fxI+AE`ltݟJL &]w1\JR r^vV1OuO0j gis{4ʉ騆)AJ2܁g}Y'R rM'ϤiNM<SAz`nvӌ/;G5[/dx|6oͿn:Y.yfr‚b 8F1"pلJgOy6]7ssc{7.l9}Rwn[~h7^ITfSĊ#9bicDa1¥Do']Lc;twdB]ԯ 5kBmBYLw$)524K'~D6Pb kSrJG|vH9@5mV<+F0v,0a۶ai{'O'e-@:Q1#?ncH[0?>ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbϦiO:u+˯)ɪ̲t9mJM6gku1k2'1 1M ^繏,8<0N33ϼ;"?W^k+MVOɴԠZCԞ? Pv=85OQ=V)c2oBmW*[XY䡒8VOm#9a-hAϊ^-\ctdFuN-(~89Vп:巐%A ^Kum"o3O0[Hf iFl㽙Ä$F@38cc*;#8 GDnfoO?u+A1Z}r^.t }51(_^hũ2şHcɒ1`zbfb\X!(8>{ϖ|0_K$-%`#w sPr&mTsT2o3dwc|ݷhv=1o@;{8W#lu.Ei5qiuq/u*Tw]y|ٵz|scrN1b .2LkdyzXBrC )B帲o;<Z\jySms}5H#Htb\HeV2ަ gj;V=]YpHD_B suG겘b,}"2a8C&%yI(/.-vri8F*@$3}ŭ0fÒ@>3GOexġ8D\U})'0<R'F+5jv贙qȏUG!>>XCB׿?獟|y?'XyaoJFxa ש ?6B5g?K(~Y3^*F>T{Pr㌏Cp%8wl:vy7t+_2Xd;+1j^O=5 >8c6i8pqn8o=f!tg.틲 KLB@e-em,XJ7U5lv7l|^.+LeFC#}p):``;9o\f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v}A`5kU-u}.c+TL%E?>|m}X q,s8̞(P#O.e؝_dd%r<a#运NybQ!RH8`KZS,#L&,b%!bW)rŎ1 &17g3מ=&.蚕G;Nq 2NPER%v4]c3D##GD9/yϫ>gy~RKGu0y-t[;Gm#LJZ)ϟKG1✄G'9T}/:|Q22I=7k J'f k$SA`]@? |gky*">wFČ Ulhq`.A7X{o#;7@C_?Zth6ڞPƠXngf_hd;qvdgObG/N?8ȸoDί<NʋEH@`qRM7Kvщ+G w]CٸW|ܻ>gڽٵ؏YL^̠1kzKwrGᜐ^H5}@}?(.>/n63i9Q8:}/$7+kN#. >{ztE,$JGχ5pOVQ ?=$queE^lXg1ywR{R_J[̼^7^} CUCe,R16 =8S8OK/S"־ϟ8޿ܭ)Joa 8?yqq/qzz>;{N|o]Bh&J.cX1=Qۙ2C7F R[{w1c ܐlOpv|dxg {3IzCe$S"$7Yߴ8Y<@ĞN U~G<Wg74M_Rqy IJ,(jzok=xTa8bF@u'ǡe+2';>sgSb͊6*ثb͊6*ثb͊6*ثb͊6*ث?>l_k̺Z&D*EBGCO=]ᒲ@8D\:,|WɃ J>r$WK]Z~fy,myt<c~`MjߘGotc˪5 =?ӻ(TEFSCZs]ۘ?GE1? |7xxE$-NZw++nv.ڏ宏{ooXNQIo2)meK6fH89 3@],~c9ā31 *JW󏟕~M_8_NYA:й=^ R~K&=p@$!2 tȵVM7>>t+t`VJR=G℧×0qƿG}{ynQ)q)`e}`~iZCƳf;ԸnekHo7x4UkR@~7jiٳLJ,F\0<5@^t&\nu_?}?A޺ 5;;UI%Xd/Ȭ6#s+Ebxz1 bfLM%#߻Vl9e A F݆\o%~[dy:e51J9ցo2M;@ +}PiLJPHX* z^4)1;k̯!y͐y?~Ia KQS *-VunС@'6 Uϭˋ=Ą*zn]a̓$+*Rp} ~M[G{-/LҼIϕFꤴsBʮHPś=c&azF`zvG0+r6#$G1oxsv{/_:ֽgNG+mruǺ8Hw =zylv֟K_Ô< I& ؽ6EA)eB<2P}8jϨɦx|r9z[lbqFx)7e*ߺϛ9fa򥍰:RĖ[QSHT%V9Ǯ19~ʔc\5\Oi#S=?Nvx+=q]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUO̯捎q)[?1DdNIlLs_`zWG8?ngoˑm!.]Yo r V#>mW?5Q'?+]CXv~i3']O?u2*ǦۦjH׺*4 -CC5 )2vbkRrs4Ocg/=ψvu5bb5ұ%ࢹ6 ,@?]e2M'2]~ W1nSV.dXAWV|C* qnc/`͌F 2bez o]vw! 3zz=suxR"QlG(є$gݙ9{/I3jZzг#$ҐF7PruGr 2@;11bjx.ϴ?_ɾr0/ Z9GW}HFty*|ퟱicO~ŊWoNGz'xy+~IW?+|ՠvV4]oЇaTO\Pgdkenrˊ};#{.ϝ[MZ}WU UyGNRwޖ! q<ۨA'/m9<ݞqDN_}Ae :P *rjElOc}=P29yD|=>/K=RO274mEKGjOϢ'gpx#>/r{{RMu S??QZ=sFJI˄?dZP(Od&X_(U>{K}{[3[?:c_ҹ5'7#՟L>d>i;-}?}Y=.ε?4 >s) cgQ.ϊ͊6*ثb͊6*ثb͊6*ثb͊6*ثbɇ/<[:klH{+ "xvr65\#Nq=6"ܜZlE2e(J Bmv͠v}.r}į 7mtIH̠j;BS8Ģf&68<r_ϛ52]kNƩyԽ%Nk;혙SsɎ3<)K"m\a~fNBZv<=7&qCQ,^ce׺UPYm*z0IUM=uq8rHL|K,e /D/EcU_hgBnB<=?mq|_}/#K]8qw*VqZC^V{џ/qݏcz_/Q;S7WFM"]60>ɜRbFc+Z̏Vc8|=Wr|fiQ/4j@R\kv4ߍ9< ىcA4?=OR|vspBu;Z'? Xqw|ٱWg?qW^''nMܳ Vke$$F7ψӍ>:yhrH׊]PNF8ڭ'>s&qfO|(pe"~?C:]ͽĖ$9VVR`EA3Ѳc "y؎Eϛ5?<>ˮ3Kq(EOQŬX4G kxXF:t8zϋ4i88g]4t'z@r[^OW}ӂ#!cC"?d7.-]];L:3u31r? ׄ'. g<# eV 0; wv3 Z??S?w Kӧ=)gg?;? cyKċOs,MׁZ7!hv<<7 7Їl5 ?'Gki'?_݋!t_c;;G gծ<%󾦐G?.PSSv$G];nzL/Wf|{˿OA<mPyt>uP>\ثb͊6*ثb͊6*ثb͊6*ثb͊6*O0&ז-#JŴA$boZ#M]D~˻s4d4  /2:V\0H.-~Nſ5?-ϗz7|a*Zȇ~2L$ BېV;7a!, Tw#}DNIĹd7O{r >u4mwVl Cio$~oWj1c5s$qcIwD];m<6ሜGpvH 4/܏?>OѼe^^P6I¡kgq1K%YYw`Gnx53x9Q 1l1-BӉ4ZBfL2 'sRXv.yQ BWs .<+ҧ;_ga׍*_w5'蔣|Isٟ󑟛{)4:vo}2[üAVj\/f;Kz<8écXyMnXG /Ig}=w~[鿗^V۳u"9[/)(u'GɆ< N:wߥ'MX(ǎ37+X妗A{9M{|4r]<-rhMBmJx;V}ϐDJZ؈">82<'I!c1ǟ=0Ui_ڟ?5ˋKI,kfEZE$Ȏ8|B#r匝 v|b2ՁRp|~N:`Vz۳;ycw^A6KԮok/GHn[㹧K^<#yq3vbt0l5V^: iIK@pD 8<miGovO=So̺vMkN=(ki]A흸&$$<؎)Ȝ)ck$2/.-Dg Dyy'F^/0Y,\ʩJP@{ CGyux8 _IJ6v0n9JPw}?Cczא x=x/u{eomѝD=xq!]6۝T:,cUŇlq5{ngŎsތ㛰'Ɨ-_]mZKNҒIz>1fmdHaO!DMۄ<ڱh0˘#՚E'o*qglF}h^ZąH+X9 TU¥WeU0Q~$# TAu;Cm4NLs\D\;:,?}򿛵?$o|ͬ 0X[.{ deiU9=i K]f>(j+(1pᜎHJF=/za<',^(0]{mf{'&5*Nc AыDz;VzڌrA6AdMG 1]$;7妗W 7IgKķp8~ȥiԜ}Y)d"˒*3-״F7c-/SvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v}ke~䫙6p/--<}ef> }g#l_澟쮫K7WjyScu6Q 2^FFq(aLa#}Ę|w?5YpKW.g~c:DEӤ@VhґDߊs̻/C.C`;MS< NΩ\7z5Oϲun<85tevħM}G:Y:K2{'=ҿϓ%y-oc=&bh6pITf_ a<#8`kO &9As}"bO㿔'姒;W6l ٘ 0"/w.ω^`k0?8쾧d*P[F$’F}GW\SM#_e>Y_S*Cvy+=]]<9ek~HbdWyX2bXE_PFR޴ϝ;Gf~:x~4g|qAw}7lᆛ$pd'g55ɟ*L=KG]}17ӜthRD}g `v|yf}#>U1 [J$neUB}satG\y$H}^+ڌFĺJ#ʙngsCot>3zl@ߔ4ɮ流w8,\>8>뱴,u E!{GɥN3d.7g/gnPi<8 ͻ9C~]M,`I)鴯8r=(ҵ :צxMpt3#t#_Q=e.ė.?BϑO_W]3˝vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]4<o 2VR=ռ#z (H8 Y>Y'b9qz 1s$!)okvI<9+̷>:f#xcq ]HSЀjFah=،8pe@v3' 1F"$]` 2-M/k޻}}{b` =`ͶcvW:e.QN#Y7ˑ-5}3axe-:vL7u}?:7'a>+w(Dƻ*w5oQXɧ)eʥ߿RǫQ$/a`wnw"K^bu:-3G"o,b s:=VVuqX,xC#(>-^lX8gr㔨ǥvyC= 睞և=; 2hTKw ^:ȊĜl=9NHɨHn @Qؚw]aD8v"ݝ{f5_2Q5O*VZ-އ%Ib[r Uc@i6;36|xqBpϖYcN|QR>{˗O9NR<%GXk^Yi/K0[$FaY)q{SKi ⇦2;K~cWhw /.m̟woy6I_M^ʱQa%X|H7YwU⇪}.F-7h-[z~g}ZMgʚ`=)dxGXт)흷]Y=1=D;| .2(s_k_S[giqyk@}h"ZDMCX'Hb F2ӎ9R Ƌ9+ 1yQֵM%^[]CIQTezBk^HC0bN%Yc9L ϦRd$l> g4"7nv|״,_ZZ@j)ʶb\wg$.[@t}gi焱8DO Ǝ{׼1M'K^iteN.ewVqh/qBޚ{fa(Obf#/T5[_R&}6c<(n(pf46A6u%~ibdy}s}K2W("HP=Iq7cbfO1QF>I7/rǩ͒|t71{UgstNϡߝt<'aӅن_*jsV O oNcjzT`O#M8z17)O{ṫ'W[xs<vB|iok|yndvR;JkIy;U^HbSuُekQ"#f㎌";/Ն |?#O2?8Zճ]i^Zm"ki!P\^I2ժC? ڝh8F@$_ ]v˥it9H1E#Ż8ߞ?23~RycA}v0j*㻩WS UtݟY4xtp X6aҮY&0WE?~A5/Nf˺%6{;aфHoEYBg[459rpB qFn7z;<eL#ޝvM?]szfeѮtfFf(YE,fj~jd?' ]vҁ6rn6̂e G=gdž?֟?ڭW8l~gug?=/0_jߡ8f w1>.g綴0N{CYl2_,{cW:NZۮd7)؀F|$.1˨ءAg?4_LQ&y`Z&ܢc2Fwa½B7gW?1qSQ#ݿGrҰ~]}mM^>{-k'I4sf!J҅4!8 9i?-n3Kc)ʸ$W7iپ DDr;?nk{SӬRK|(^do_*}b<;Ϥ#h~/K:g.;㛳Y7bo]Bc5\J^Ys>pABdyI f]E5ʒY#R85 =u =tbG#ٹkN!s叟gOs7C);~g? rj5壴}hKiXRG8*+@A G{5&^Cm8B@}t?iluow;>b4?0Hz?-<ޟRZszs8'WI~^/*~O3]qB>B~Eh>ZMIvgdP]O/. Qu%3x/~.MQ=篺vwgGCԞm? Ϙ<\|I{$l95 l}wSsiXe*Yh@c;=^n1D?S?w sCot#SoQ%JL ԏ'Ϣ?sV}0:? 3`O{%dG:PO+l,k/+]G>*g;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث[e]sP{zFqϫečʝUHvNŏ4p~q2hޫ\(zA˲%ٱWf]o, 4|m"FVue~Q>! ix<^$a*7S=ͻ&c E!}A;h^K|ajzmk[i5]=LQǧ!3RL`( qti<%(.[ d_3wf]vlU-u!ͧARMFRR@Ny~3] Z#\B9lENǨ]g'>X(HU!;\,ظ͊6*ث]<۩Zi5oon䑨II.U ,LEH K,b '-V iM@ͬ/~q;#ܬ2eť};zP.qm;M.fs8FCwQXD;8ם/Nl9Y4pDb,@;Դ"#ŬA4dRHأ)#b,,DlHx"'A6.Ykf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vE{k鶲]]H*^IdsEUQ$8@ܞAj!ɐ HZ5ki̗ȼ5I+#ݎ_d![,&?8ff?/O5I+#ݟK4+;;[{+4vS+T-b+Ar$K(4 {B>3aevF<9KunykR/EGh bd#3_MI#?7_̗ȯ5I+#ݞI.o1p*1^%(U6ExLV>ӑO 7{vGh௢Ҏ8WXnPg!P[qA13?T>V+w³/MS6S_"~ȁA4ocHO,gCxa$'K֋8ᆧ {}8I'[$˄NznoK^GonN8\~t8FQZ韩zXǏߗk_'ć\1%wgVyߟr'\Ӵ;Q4Ӯ$GrӅ5 ُϰ'9ğFl?'v~u n&е~j/ӞF)8d[ҟk8s\ߔuXqqis@0+w=GOHp*;Wgvy/(7g6躏Gex/K{[foIC)G`{3vId3(ԣ]Ar;O πQv|w2hZU԰ -3 pYW`StvaݩgrD(!5Z#eٱWf]vlUٱWf]vlUٱWf]vlUٱWf])@= h}U')jVS&[ؖyv0m#JXO F(偕yF&XHjaj#y@3^oQs Xvw||]G7?+̭WzY4-]Zu쾤,Ihkfݥ <4'$Qb*BC|GXCE 1,0"1Gȏ%пdA{f?N}Zhe5;u͏jv]χ)\R=q]|}.g(G>9];8msfhZW}#Uny[*#ݪ(GPӦb}qi]e*1Dy>SJ[pv@3  s7(]]?/W<]FGe6E+ḼFxt}nMV$#/c fWl2`,ȑhGn^gvG yJk[ZuV@NȜ%!SVrt0d76.,Bɏ덀 &6 *sE󅿒w {˺eֵkUPQꤢJ^Lɪ&LGS:YrGqKȎ;o+h,b(Dzy.ÍS?LK1gjzzŚiP -3F$?R֍camtc,xqg)}R~]V<}rRc%?Ik˯-~Xm2Vz\+ {coB)H\F .3 %kt#:,82N&a9"HtAdg?6-ύyW-;\dԴouFw HqND3.~ϥc&xe'8.@5z l4F{$Do;y_7gsvϞ8k{2n,dV3^^Z>pX$A2Kj+4]^kFhCfR<$4*F& q Or=OO&~E^f7>uai.Z\Otmn*ȊVUIAoj{k&<:9Gɐd15cg\?cFS f<7]I*ʯ=/凞Ύ\C MW,SM*|KY֧^kz7=M 1g4j0#s1q2 ra„~]e81YbfcDl:v o&sA}_ [\~_׏]2>r{y_AXcҧ+j; ë1,X||y#8Ԣ69yNǬ OQ'; R6.-񿽵b9"IXGg˴c1j 9 NL{fH21_sa.)WgE寕/qo'],ZDrZڬZ`|rHJv/fiuFi Fy#eC1Ëdq/˳󒟖OW]AY4nRWp$Wb;"Z=^zX2DF7-t1ӱ!n΋8.F?.9+4&rpAVIͧq ˖rN7tW:=)w'?:?(n`m͇sH2F?7~G?E}eo_3ߛ</,' e,ֿg;77x;7_WYOA1DY?vo~ovo(/cGZɜQ_g?_(f9ٽ!ٿϢ Q"k&s{CE5DE?#LfOfj>H2F?7~G?E}eo_3ߛ</,' e,ֿg;77x;7_WYOA1DY?vo~ovo(/cGZɜQ_g?_(f9ٽ!ٿϢ Q"k&s{CE5DE?#LfOfj>H2F?7~G?E}eo_3ߛ</,' e,ֿg;77x;7_WYOA1DY?vo~ovyݮDK{8PZDGG,w[-\Vm'߳X=pe3#cڠ0ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vwo {Of^E ߑ<- 5d=kaLcD$7CV{h|LG[FiiNf igA%jM @؞͛)7HcF2NC+htW vVq~[ysɑ[|6Cefe>3 5 p{:12jI6srG=>2|Nl| Gr#;5>YZY-Pon +-ùdT'{3? KRn}c̀~=wyrJSҿ,x5?*%+.=,fbc#%ն#0GMIa|Rs2ɻ/jGm('4#4 &meˮyWE[KM(Z17'-1/ mBM2}: XN9g)K'"8=^=Vn) |qvj(</tٵ?.궏kYrfpIIuqEf",v2 BD Gp{=gBB6>c]?r&F/5-u[/3gi=]>hQ*v! w6%XWY1>7$C !'%ˣeu]syAWV-m5,ln3CjsC u=whe-txxd2FDsgU]nv <$0F|S&S#`WZ.\Nm[Qk[[a[9WNcIƿeE_:ϞQɈb322cp>\]5@;"g .&?56M->=?Lf3̀ +ܘ3cw.Q)r X $rNS7{mvg7h&<3d@;y}ȝ^ZyG^3\/%"ʪ2eeeǭ˪50(|Zu4{.  RO&{;ٝC<$d dsB2$HF&/OQ)33 ';<o/yM6;Vn< G}c:u.@þϷSm$Na#8h UŹ5~S,p8213te"˓!/˟g 5OQ.zӀ)̧-xH*|Y4\QËs,|>WDǺl=z]jWݝ~K5|^Gng7a,* -GT~ !ѴU,qɋQ FۊU"c@9fgHXC[onNk6~Z0/ȏ9^yIḿEd=՛ډZiH%h1 $Ii!G03yBb$kg}#QX2&P<7gNg7C3Ak}o0܋\n+T̐5*ZY@Ybk59;S=^j(m<+ˊQ$6_8J&oG&CwT#/?$|W:Mm|- =W[`ەs?eCP$/DC{߆j:/j8%Ǹ'\]](C ̍PКWD&evz-g"'GQяK5G]A ^p^q 8_;<δ30&7 k&V9)yDyGntO+jKj=ǣX%mN#5=ɪkgd͏"Tx>;yXDa.?UqJ\-䕥ט<٠yS.l5ϩ]hV752OQ䐫ʮT}1Jcx28!q(lH>&̚02HW z;8^#O)|åݙ^tܴE$rR7`;ɨH͘ ;D77ۥ^W "on~g~egwZtk[X-ֶąĒIYMhҀY=(Ō9T5]_ɫ&+:j[ݤ/ٗ%{O8@}`1e;]7b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث3Syk~`e̋è\ݥ+0 |^ƿ& Ya\@֋tI@? v!Qƿ;}^+BݚD.Qิn\8ؔmժ)QYƿ{/Uc8v-x"sϖ?2/J9~&trEc_UGZg3ʚ8r!3uyVx8rgeE84+:R x2"?**ᇽFcCkLJ̑v6ށnm7V,o!n2[ʇί㐔O)Du91 Nƿh5mOȚe3DGe{U"x#*QMoJ{tg9"ss+Y鷭YgX9㜲bT}>UÏ6YN>c~->(Dqv|g!t?&jVS)x=1rVNckgk}hqlcvGX{/6q:_{˯3PKy]+Y "+T]i@ 8f$|\\Y<3;%zNQXgrr'w<#v> NuUC7pɈ3DkqtT.[˽>& TKte;VXr4DAHE> b v}{~SyCG}+-_KƄ}MkJGf/_+/i΋"%\5~|_?~>aեc&w* NxSTNۮq},Q͇$%tL>bv>`Iia8E_G0gk55PFvVWI.i8̞I R;-FJe3BDNq n sQ 0@~?7|qwm|{e׏SڊN W2^ms phF}λX刔H  P14EOƷgi=Mў2BVW ~fA\ <_lAb%^݌wo0_,O؎le˟O0kg%D{iHd d+v{s[qK:嗑{.n"` >RsAS|`Ozޘp yzǀ`Gu;>oͿ[y@ҞKBn#Jpu1*+gvwkH$g\N9idgo&w$C>amn,`K=V`QKZt>y'ڝF}]jsBr"3Nx~C}ݟ+˛u?2RM-9HF44 B{g=07Ggӎ)āC(I,_Bx54(Aʴޙwhv֛gHs6}MG/06vq]K_vgg/R"ꣵIVG,Д(nٙ)@wՏM?<^]򞥪Y=$P /%T.\HGjá˜qB2`[Aw>JN=H(O(SM)b=ixS Gۏ3da";}cz>\_j1Hmi%b:* @%@$ ux92J1Db,$;=88ŭYdi_nKtnQFJ%ulk==88}TM}2A6vF<.oi^VmgЭn u!^w &QG3;}4ɞfreD1KGZXihwK;88٭OE2\Drs/MgI)pl} |vD3[d}_Ms+j2cG&&l3ĉ RgO6*ثb͊6*ثb͊6*ثb͊6*ثb͊=íS)"\KTHb?yxi/j8@7B{YN\{3'?Y[X<HZa⼹JqSsQ1po6? uڽe! ey<~ lVrݑ<2ñuzb"j>w}Pټ0[iv3w,(Ťrƪ@H]0Y3#2#`,29"O ⇛~\3y A4.,5KKy22@r : iZ{Sڼ: lD08"zxӱLÏ4 |.Gl=,OR#e`C+B;t vzZt3kd:K"<\@H[Ҵ7ŢpFdqs!hˆb*?XU2lbXЊ#Ùҝ_cҰDWSͷ_g2kx|oj[AhȻ!C^ϊ9qf0LK4(DWA>}MfU1 .G.>eGn*yӹ̡RF-YjhtH 5`rsN>Eh}݁oi w^_XYy- +[6BRGh~i2F2"bGyUa7uXDmP9'z}FH@4CÏ&Lf26/b+E1>8_6hw.<ŠZV]6_G-n9цƃF9wi{WKX<pX-a则 ˆb-$?2IA5nq%箒F<+̚œO,:1Dp#ԯ꾟[Õ۾Ga?̶:ϧ?A|<ξeEM6NE)kp2l3 >:nLAŞC܉'vvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v~?&o4ȟ,jMwEs-v@U[(H9LjGPDO*/hd#1G AAuSC_4;}J'(R,Ub.FX>A5>y$`@$D #qͻDq6øiQry\y]XL,4%VUXЯ]]Ⱦ{li;MXyc(x|>&Ye#7DSjrj!|19>י=ySG=(6>K;Iv# Npaɥ鲐 NIHDF]NaqLD 7'g?^/igk]bV䠙N[)_NF27Ƀu$!_K8zɫH>Gw`oo2My>\t{k]i4#I(`dBJ6A}6|'(<4E ˵{VzL; ݅飶?u-k6PO˝ITEդO4rbSAI! ;I ~f3"$5*٧JkbռA4~Y'0,2e-C} Pqh{XH<=q`\/'0,DyY?;v/8}93eM}6oRIT7pa~| %M9-ECˏ؍4*1P_BNP9"v"-n4Պ[m՚G7M6 N]h؜XgÆ!>q~npy;d˺t")Yhܓ53'{_bᐑ́WR<>xorPBDQ>w~l{<.-bM84_#K>.,cRFrhhkeӜ*ߗ]/5:ޱ߄zJ%~ BcAS|+G1Ba7ΠE͔摙"Iv}I\L3?!:{d;?'?&?/<͞AT,Ѵەնh-Hcu_E)A9~OuheCbrT"G0KO$ * O0R"㏘O?w<eB$\ےB *A߻KI2d3DI;3ϫ켹3g=[Eͧ_I<٥.#)DQC wU8Y4y P&d9>O/ʟWM urIh; Jvej t~:W2kϋLQ7|n_?ŧ'Ҵkê^J&on#i0bHZ}]ؿeQᯪV; ׽;k%1WvDm?elk!j 8&le_CK8=HWrwz?Z48n.CU~%##a7sO#:1k:X#mib3neV㞱 J%S%A1%Ǡ4I2T(7m{+Kjz]jgFg!c:ƿb#yWʺ<7Q\=0i~*[ʂ7ds]=t|`N1|0xx۬졨![Hמ[PyWvψeԒ'ԄGoX* Tr4:KKJ8Nh8̥)G}s^^;<>[/]N +u8ԷR gc"O\848p9~dq_r/S|gyZXy~+jky(XvkbC)JYc#>*vڒ֜.*iVߚPD/XP(WY([Ħe{S:,d bDQXb3^ >{ɏ1EzV/X)R/RVi KʠU?ʫandg#9q\'T6c]i 7]v7P<9IM“~BV"_<=L]|AKy &Ñ8#W.Gqq6ۨh~l_\򥅲C=ޏ-o܋I<(0`Ǔt]/chI<"9qH;`sda(ʮ[0~_yS|}T֬<פ[ԭn'63,23YQ)QE9~zjǖ/\'PA>tݱyb%Hd@|{OA<mPO_W]3˝vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]5\g_cy?=ay/\g@SC=fkK}3M_7ݵ i$BeTCJѷõQKFQ92~Z39e`5~ ~ayC?o4*euc$V_4RFF* @7;ctC3@z:Ԧ}zZniWмlFGQVؒ9mʃST4bc,3<>  co._md'$ C"_WWǙԃm=x?ӦýBRkXtQ>ҊHy(.nTߑBOǕE&ƞ%1ZO?,S rwvIk7:M䞽uX(' %hdb K"۶c-9cGƼ"$=۶vCc~WNȗi~jıA=LF}mĢ ~scNY8qcF#b\K0W<ˋ-+KѢc%̟tk6<䑚BRk'܇6YUuq\7ql8 H^q2; ^A2^򯑴w˺i~g?p&XH;JmJ:΄3꧋./.""9nIn&ԙc' pʲq MJ Yu1Y:\/ec$DGL8| ;&#[c?-v33W?^eU˒$ZqN=?*04,}0+^!ie ;D{]ͽ##ykO 2׫{^ W{Uw8Gkzݍ֡ߔ+VOR 3#*(zt{{xdę]J~/yu}?⌁1;~=8~f74?+j-_N~vtkk ;pBP3h+,/@26?AX^ȍ?9?)|ֶ yጤT8ٗji[NxFxc\?v=(؁2?;9Wo6^/bU{rm=Bd~UfPf=y<ӄŅ-H+^z @jg(FG:cQ/bMrKqs"fɾ|f48>osmI1" $USO5RfG;:Q9)FV(E},L _? ^|AcvkC<\5U7G{Df~qayeԽ8nxz{8-ۗeݣ$P#:f{&]ǧ89Ou]@5(o5}[IKŻJmJ ed*9K/@A92㐌WJՑ˝eؽ;<0# &1<.`Ǔꑡ/ſ71a2k+*}ӹM$6HF=OSPsGG1g>8]\"7q>]^G6 A"Uz7g~Ti//d[L7 !3?6iQ[Hqd?.{K%K&39mQ$g28?1MlVR[$e{"42HĪr X" UDz!,ٱWtڿh,%UHJv_Q6~YtҥSx! })Z3=G/`K!(KD{Om5" yZ''4yz̗v[$Ʀmodڑ$ #(xnކc l맸7柕Z_)~Y\+}M\u$.}B?TDhh* ^Hc1㈐xx2L|3wwS W!+*vtrך~a~\[yMiWTfI WV"4]$5gId2(O_7?i1͌d`@5ȿ53/ͭyB-R8 Rvv"ENXt]0^ )[sG:fZ"9ꟗ/7]RO4\5& RW . A]Aژ#ū DK^> :!O/WF?.mk>rQ%cSNNy*㧇z)NvH'y͔`r #n\>d~ky̞gYmnHF궰*#j~G~ói.5 EzkMvpX=O{q^5ՙ}Bv_] g _pU]O+'S{(vҮY'!1 X<kp4f _7u $\osm}G]]KU*[3EPs=L#6,F2#x}L|3 Ь%W-|d5Ocs<M$ftr#= FSH&mf .>WvA;y0mM4%o|?yY1CStZnjO ώ9ǵo7DC`*uI>?#h,w"_/'&:pz|{y>bz Kg^R3CЀWJ_kR~nxG?E?)43P-NyzW 9mw_27 IBGc,VDE+V'Bi6r\G! pHl#r\E提UTn]-J9>"G;2i ~)0oG;:v}>޿?{ø|3io"SaG;[Ȕla>Aca,6%? a>Akaa6%?6Wp`Ӵl-J9J|4|Lӈ4)O m(>SdxQ 졦?LSG|\zM-M%?-#1hi["CB?m"i[?/提v ]K4'M >j4h`Mx,6? ^M6DG4PpC"|W9!?]+mB84,u-?_ ^=Jc_GiLj |Gl1_-OGiYߡ\Yyex6? yX~I4/*yO^N d^V#2zK提Oԣsʖ _ѐ'N$yt#98P-kCFeۺI/:B4(#$-r|/z"ŭygM >nH<<c eo&I~t?"y;o,#O FC!b1Vڮ#d~x}o?&f򎏶vex~jtIo-u;C-wnt=ȞA 74BvZ&q @r6YDm}Z#AsE)|q,cRx1':zQFz!Ǔщ:@myc. =z6|:Zb|w/V*By[L&_8FCpHy[W\Lڽ9RZ.XRј/wW2<\~Nz[NoG%Gmc>AUk*w0˸܊,3CTMWJ~!a>O9\W^ӯO2?$q(4n'KY\dbyS'~Ru#3y @z6f\Yi#>A#2l0<YB2`?G.vGdp< o͹SWKƴ_/7q7巗 EcTsQ1>'6~nySa;&_ɩneҕ>_?Q,\0Β7Jփڟd+V{_ˏ-]b?T9f]nl`teO',ku&]s˯ȟ˕cO/zSELA ^Jl^>i<è>;y@4k?NQʡAW)'^38r2yY]0q`c/fRlOPǖQ؟g=K0ŭ"?:x+|Ũ 7K~XY;=X}?2>ѽo?5]s O}/#h(wt1$S.l4h/]ם'<٭OiK*CW7OʚJtaĥ~nW}ϩ,i7.v9c"TO-iEFO^͏~Tw`~ǐ:m_ D?6CM1}z_3yʩS)00_{-?R5?%o뀤 |0t=濖c.!$ۿ3q ^\vh?2Cypi/*E֙Hٍ6??R]̔]RZncoM,`C&2X,X\8V]oNi=l~A^z5aO#%6ߑXjWiuL k cc2W=+ZHv>p#9y[K'`3Եxxa~I'" |4W4d11ԑjYj ԉ[ӓ?q2 - Ny>8(c~:j qMKy;E#Ky,?2c嚟嗙a|RM?k |y$tҭwxa]͏0&<3,>cԣ{8>MOXXAjhd~1fY#qJ&ƹ^gΚTnizaߖ)/xmYT9$:gQ=!O: 򆝶~G~^:Bhced@?4{+ |X?6ϵ/#F_EiVO:9|~a~uyߒ$pd#u;;ɿ&.8iO6|.'M7`ѼϪ>򿟨9GI6̼fc)47tcǃ%|--%lk$ TzvyBoяPw ~*&ӿ#|e>k8s9#m<-?v*L8_k32P ?kS8RF˯_QlZ'er"N6͇;ՙ^P՝7~y!A&]^C_So!\LmTx|Ց~y0:5?n*;}L7#? {Ҫe2@Fy=\SOҗ&;Toj*|9aS[xZK)ϚM?ŜZm -S?\@v&a" #u]v=L)v. ۱#xHv(%$ob,. 6?d"E~XN9!%v)p`q%>\:Te=|֙.Ȋ><-9tO"_M/~Y02,̘MO1m"kVPEj5ٮɩ29<8=$QxD0oNMD!e&);|gֹ|cL } *-))Ȓ>##7$HȅS5Ms0v' xbljצ`fOqc1LR$]6`,{e{(o M5)%m> ԨD3Z JSi1Ȥ;)2 ev¶bLE',[#r7'5% )&6֥7>?*n|iVJk4cI e̦gB$E<2S#:1;,!6jW|:JAJ`;|>p_{4$$G.%rAZK=tk~]axBg$%LH5=-)~e~M:A{(hEI̘OGgVmO\ãBJfH:I@<Q7Ϸ^RHZG%L xv([4k.լwʪ A똢./Gaq%VYePX[?\IA^\Sjl?ϧ\I*ˆm0IeSn[XS J)7֜Ⱦ{܀Q1$Q5J.LLdbywjLi Fy>V%ECG Kx拽L\NƇ|仍0d4ÕFakS:fe䀨Lj2cf5ygS('9%̍o_m-Uii/pߏ0+Ѩ% ;mӾ6̒G9^8݆\lqߑq2 ߄QKnW>t.ơW9NN[ 2O FLN]Z;r4'zn#zwAZ\` 2T0e xr}A$L+<@vx"0l϶k"xe)zpvק&!T‫=RǕ i҄x!ߦJ8=CԮ E8[= +q\*허.2by1!B~Xb8Y H*'WIrT#gE8omt2N2ө~:Ṙ|($Mw~M}iAP}䞿_|1GMWY/IO*i V8REw}&N)nTֿFJe=3 "ݗ14gkItEG%>N9c ƑWoM}l?Ә,HGђ \&CцMubS/쟻 Iƻ ӥJ'$t0"nҵ  #Fwt7 ug֟4M)/ЎLWn4'b?WT'f ^'bf8.Kn_@CuuM>IF"tYg+ a CZ`!yR6W`@ETt͛Ş嗛Ȅ!Z׶e5肴C)L:I- HH#T'*xZ XI5jRM^5us 535̻jr]z.f2(*F["U&LC¼GyG2#p3/㗿|)ntym$ibѺ̑0]v]'&ogzj |3h(GQG)m[WddRMn]B]GƟFG2,ѷ6S739:Op\*6Ii3m,-NU 5QY&Nx"M%}xfDY#,>x7gt/02w>؋{T;n9Qu%׵Zw=9g=.&oc6VRhaFRzV F j~C2 ~;zz.I$)"m]_6}X4yҊAVt/9-J~82JdPR"yv#ᾩq SYogFICʀaYfriYy990 V b7$׷Ns6[VsH3<2x[V2!8| !@hmnG]֚BpNCtp-b=r&iB-At圚Rx3w|7IJҾ9$ҡ2@pʍﷸC^ِa& Q$hwol= m@FV$)=VM*6RJ{mIC>62O' ,G^jz|u= D-۾ksLFTt|?4]NҢUΥiZZFG|' OcEPIˉWbuj Zli] ^8Udi뿾Jԗc9{-26H 1C,V$~i1sL47;m ytJH8UؓA2-r;-/ t4cmFV0WdBd;83l5O3~ }tշHdKt?E;Hv0'KIX۱&1Wb,!?Oe˳曈aDce%`l#Ͼv&w3Bg*7-GߗKj˯-?_^2* $zr߯T )xEGj"zӏs~}#O]+ڛ#Z㍍Tm LGBvGyg~q i"~95OBk)06W~\>w εOƻ) 9PP-w~_TX,yu P۝ʸx@{ח?|StE)~VY3ۧLNڥ:E2zP0|qnMb")ȯz].XrAH ,,m-gƙ>;Ic۱p;v,˩ ,{Ų!o#!p2om,(Ps@<'z'v_ (ܾiLJDMOlʠE? `Y 1/%eAR:N E]-(q&ך.QP(ME+MdSp5nv65Ȕ݇)O@$A,}sް 8Z/ z0A֣"M6Z dӥMi;,I7Yp3_ ʧdBAV$`QT{9[+y%Sga ӠsywcH'rkSjɨԊ9vr"`hinXP>dA%FY۴;Nε}l;PRٙ6)mOMƻ,Oƻpo3ѹ***;8jsa/L6@گ b?_q k͎slA }_˨,tO١gko0?-R#B֜P33ѵ0Uא4-ؕ`hAڸg%bau,h@0w̐)噑|FpEXt{ҝ0*Q4B~ӧߓ=I*&=.s`eR(Ĕe-}Q*4KHl;fD.5^>sO6L0 @6aNl \S~NìsOy|[ wr`x\OGb *( v׼sq|T5M{7Q S[i:zmN>>虭H ̀'zgngfY TnϦ^֐vۮa噏@K?k"j0BZ) ҀsՅ t5<0/ Wɦ_DLH?,[;wV^ZP߱8$>.mȁv~UQJuߡ";l7`y'(ሑ'< #)~O}J^ 2'ȎyCfzUEec_=sKUB|@Wso^K=BIhA78'\)5+8HvPB[G`Ӥ&o?kV IT:5|g25ŵOqΞNfG/፴t O?^6Åؤpzuiv 5Eg ʧ`u#|g[[(Ȼ nS*'bھ88\IJg?(h9.p6VլR>3ģmNIJ- "v4p' @aJU(U#Ɲ끿HC hF E&cGAK@bHw |wȮso(㖀ċf=jEi,=B@G^o?R-NB%UgccTRӮ^=rĆ*zlE%#Y6G44+a4{&Ōkj4B6ڹem3 Ϡ7tyh(>Y,F=G'ÿmo/H^7Nvl8f˛gkҹ4&,y^(iq* ug;=ԙ R['޽EӞ_wKo3C$S}T4ĆăM fŖrEjzn{{јv g8GJA?V0=O˿"1PNkgX_zvHcOڳWu4sӞPexnƃ7; ksb>5߯|I^rܻtfRztʣ zfs4k"[uf og"?+zy͞lwgNA'1k w#S8~-oYM//y^,`9wbkY$jc]<2TAol2;uwڄN>7byĢN" 0_ł'ŒڜZ58ӾDu۽0$;XF^җ!^:57U pSr)0s8m=KY6$՝)CP9c%ò z? IefD1f veZ? lb|2XS|Άǜ^tX㇒\vcIG”fVڗkPY jë{*co.|iHF.`sňE43qH޿?ɜPq,Ξ/w9f,hMGC ,8vg&K\(#WkTqgF="aC ?Z?)閈ޢWznW"B΄G =&[ I4| S6'1:}Wq-& -OOr%S| 5'd.ۯq^*K,wYsՅ‚Q>?vI1?iQI 7]]:0x_Z/#)<ŭ[kĖO#|ZU2F[v F_dkO,#nG~4;k$LN9dYS`F槱JiBr> @I]N:~5>;9#.<P#ɴhTQ'O o+6zW~9gxF_Pj:ok{횈ZXǍ-E؃0+$bB_-ٌ%؋Iv00"ݛԧōi 遍;}[v5ۊ۱pvmKl6 v[hsMJ!5mv,\偟!7\H,d7 \Aqv$EFkblE]Ĝ ;Ƙ0Y1dc7J bF\UF]L,آPxv'H؋PŃn7"CdfFv @ ~b[l<_Bj$FZ_[(p}E޴=:MV*a&*%x T9F½ruMn(+,%|SsBIid %##~??ׁԮӖR6 "£;(")hVڻxbDa{|6H+$å6+}uߖJ1BZN; Qf!Eڵ?ۈM ‘"m dC(d9~zT̑B֣~7UV/n޽'vם$qh,jrk#Ӈ0D+2v5Yj5@2U'_8OOd\&10O"rhqk;(g5&fXʟKDSm#;;A/E;7)v <sŦ΃wIoEV .V;ؕ }BI.%F e٥Rdy//abi2Ѻ{>> 4dyd*GuXk^tK54mSeO-Ѽ\}U=+ >70gJ L6rpp8tb@bm;퇛 VtQL1V}\nZ H:m6! ׮Jґ߄ /G% )T井c˃7ξ .hz ǓlBO;4,;S shʚw2i7$l|{N6j'm:O˿mpO;DȀAߧq}VOE:R慇>XӚjM&geԑMV,2R* "9;85q~׶!БH!VA}2$SM'W^kp(v]}ȐSŸe'&P!<ǧvޫgzn+׮bj#)[, $m3Zj;#Ql~il MG{cZ7а:yUg,vq~<=%7 +o\oX̏"Cv-J0^f9*`B}nҀdvvl%Na,"U1H Ӿ0H?|(DiqE;a,׭zr1`϶+M3(8-!zlC~ ^966<3FSw1ۍ2l#W4ir%Aϛ:|m/%•#m~; :U27iBxarH9r̋@߯]&e  ʈ[VhB=kB: G%0ImoJSݢ;<2XR{Pۊ.|0ic厧8y6զ2( W%12eUGBZdCV*Nb݌eO]x;xd/u4>M~8(e#ɓrOZx ;1ZSb)j.Q9yɭky{iTMڵ۶ ,n ]ؒOz^rGl郥iK9=eCJKW@;j`!D{0jNiZH8ɉx drY)#obS}r? Oʵ425`7aBqk% ڻKc$w톑n"ݎM]'`9& dW -ا#L+HhE.KxÊφ #;q4ʋic학Sǧct/@) . }9&.\\|:? =Cq1O5_Dy-+Q vCXHAW/4햸SxӶء؏M I=bB1Ķl ibqWcw1.v.];$lPH7@ vv"jU-$=BhOpsי>g e@ߦkKnh~KhUΓj j\Ƶ3֓-?;mgF\[ASHuYG)_s QH !T 7t$R ;WZҞ9_")R*3V ؓҞ =j}` 邐oZW}zo"ѪV+)0's4S᷅{`iNN 2UzMwPWڿAɯi%ڟ2Nݺl~X+}Gcѩ no,4!S^s/i?7e[,|[?rZ^2 U'yϿܣu"S0`1nXQ+qs]0XEjiֽ3rN1n-ym:ȬXkCRemqdT#t(Mz䚩~iN _eCӗQxȨ(A5' vy/ufPz2/濕:a l ͆9q yv*6 e55+&+Y K,]/ 0 $^mX&~3-w1 w4r۹!OlZhSOB2"dF'Hʥ uCuizvU7S PuUIE$ c o~8xNW b_5z~syt4|8o ҁykQOy,9q۩˸ڈBӿ1hA t/mwv|5 t~tKӴ_n.#Ɵ;W\~BR0a7:iH?-=H @>s˨ vo# uv\7o׀'HP0S<`; sٚ?bp_64 PGߜ Ug>'9mF4dB:F9c{o'"$a V%dQ+r Ӯ6ѩdD}FtSPH?*CBF=57}dx[ }M2dA;=mZN6S qV(0xcjJ^J݀vi홚xu/%H~uW)wΊ3/y}/A=u]9 :ј5Ws.2.Dr?&]7A{7lQ _;)Ġhv_iS0K*l :咄|<,%u5P'CR&ҩ(| cIYTOL_$`ol,H~\CFaJRhLX;8L˺o p9Z'T$%,ݞ1PNXR:1e~X]Z߷ݜQXûL G~iAORP+_!zk? IEV7Aq=!7++Lu:cZ0 )֛f@1=KP!SB{Zƻ y{o4 O}/lB oA?Sjd{jiR++gHִ3M59z CkBA˺` bkBOS Ӑ'&{ ^dhl+J``_*~NoK:~zdQ9Quk[![#';R~2#_^<{e;6pgUM|Y7͏,^INY$.9vbq݉NI2H iZi6Dž؃F 3Xӱf<@K1dRPu+SB.l1,yb?( nuw䂑T`.E/$/QJ]ʻ|(-!(ŷ25-Doy~4,QMwYⷊ0t uk#>eI[Fm3 Wr>ߕ0/d>aH$xt훬Y8Gv:MW?/m#?S9T׈Rw?1s_בn_N' E1[O:H+geQUX _ $N,iؓCLT8xi $+b`ݕ;t;S$jQbRGacN*F;'^Vр{KGϨvIZ2esO[s$B՞ӡhmXPө;bR/:յ[ժ~*=)]{m4'+V5Lbu,E ( p6;6e=|(?Yr:W'jױ=zeHz6) twCZvdQ*ʴnlݬ)M~;uz?F]xTncd"kә@ͮw m{I5=P)L^occ{3.~O;I?-,Uط~$~d~Pͦ"$oBk xy:uwj]rOqJ5/Of BrAŔK:S\#Ң+0R;,bOL䅠0~6s_7~wd N'9Wѻ2$T|OÈ24.E S>w[Ie+ SL _$xKٱ[;I(ANK \m3ia> ɋtz-4V_=CEaI-nQՀ#3Q2Kpcϑkzs$O@ )uk}&)JmI/?6JV8@钶Rrڝ<ᅷQliɴN=|0_0F 90ÉGI-AuM !)e wn$,3Nd(m97$ @zѼ[I-gfG,Sa9_̔8䡡QNߎwĹK(UI)O2FL+.|ϫKp*sZݑF+P%`Yp|Rr/ZRwS圃 ΟOH[b es, PRnf0RCo)X֞RUF)&Չ$2z3yUN%̤\!࿘3ۮ"0LH; L&}!-v  494f6=)\٧ Ɵ;`Y7"}~TըfUVK<7585j@MMMvњGӰz'GLH N~9IV1=p` HbR/εQ6:nnZ6x% icFE4v[tѪGN=\Kw&X،- A\`/ZdPXEwpYF)Yv#N]q^ULwv4>d^f3U[krhe& H#=ƨAӧќdn&.3c TYJJGr)xL qgYEH=;uI͆=P Mʭ5!a\@ɝ]iYE )P+? [|{\JTFd(= -=:#QM)r R~zpa2dpOoɷ11`iCWgaU{DwuyJ Sa]N#fw;W53cL@{,u>ǯ݄mX%Hnl`# M&B 5ի /JѼȿvy׶Y´AG\{>(Z)zoPľSPEևIMk)E(N,8m„W.ZP`O Gs"r25uVmKWi%bwbM mO6= w19`:ӥq)ɶ-iBw5ʒCP шnCnH[Ț6 m&Iѐ7=9r[ռ7nUڧ3E4MyːhwqdZ1@)n1[l2A;D(W$e LG Aiw`Vr1kv7=Vg01c^$`jM%MOlP&8Yáō']~n?矛3ɭCGqͽ(<3mT)_}[vn3Rr'zl ?"AI\:F% ƄӋS`zoj%U(Yԏk猅BSnSnF3tܭ<j\$5yBvST7_s"q@܁oJovr*z5մEi t;V$Lteڵ;$j\֔jBWƸh!Xt~O|*|~ E&QH OjAv;|n n"`*?G_I~æOu KB O^Mq(޸4R05fؾW%4L\Vt~9TO9Į$/]I*ǵNlFnMѵHkd2 @LFVm%Ply;$Vֻi]6R2v85DZBX70„0{rueH5L|[OOET&3~Fi:imFI+Oz{kJ!ٳ§8Qy4Jwy'R{W$ N|,21'wo%€^WPJ~InG|QWEF7^Rw[;U$(Α'֑YMl>yXA"ݍ)Nݴ -[Ve3byuڇyHcC6xWT?,t[{m_ 㜲0G.mől~Mk (?dyԡ Q˸=r30.fHX`-fxWf]:oh^}=suܐy_ϭ*JEz Dd}\D8 9?7 Yy3"Op4唗jj$!R@ pB,$kcʼni$U%I߿`b`ʤl|< 42omzfKw"A:P#mt%HJ 4F8[=yZ=VîV.9S0;(ƞxx(:bsϚ;s$7r\c4~Sl,焷C$ 6ȕԚbm#⢝|) )r޻aUu8ĽN< UÜKzuq; o"L)Dɿ5 6XPpHai^Ca)>jX"PC Vp_5X}j;WzʀMv;6> о4ҨaP>DaЪ3@ĦZ CP$*þXzo- )1~@VPAq'hҘ *%S5 iϐ">n9 xJbp9w}~&[g;EǞA5qhڕ~z }?vt_-y`ubO6jߕ^$bI䑞ѵ|Wa„O.d %*‹µ+P'|_<Uh::bi^`HS\kǧ^3a)N@mxch*_M*ke=2HDO"+iP}YʏN:Ol9pwO;~bEIVR<-/ _-|]XM|:a /sL-VNhv`۰70v6jl* Ȏ ۱1KgQ ȆzU~yL%)0ϵIjWarf0?/e4^޼T c@~ƒl°5 S~YM"Z|k>''Lڷ RiN314=ҕZڔ8d+51uSJGu!i+E5AFPFeiGʼn )^o=I {P,>b|P|=U*joPS#,o"(h dD4=҃)1m W PoJv(FD |!G^؟ȱil"Wr|H>MTtHPEs*|1`rNǵ:]rՍFnvNL;:.u'4>$_ۛyjTŴc?A|B0Ə'^$9Ɉh˅W>"9\`LY'b= [ h|s3~LVHH~#=-5_ en MyJ)b6eIuvjkJoCvl2iA {o}M(i R-KHU6=)]aԊ::pV9XEߖо Ӡ~xO\v7?a{gs'cZt߷j9cPi㘡ֺT2)FaIzQ3҂n:{drXBBMp%0>IU/)nysU:"X 5]$qɉӡ2+FH:vh˿JrJà ySКENW=ƄkA `?5S" Ӿ3-pJPTd--(O݄:yb*˹)e><@B>tpn}o3 ڀEۡ%yܰi:fTq}H-QݜQN_Jxh4*EP#^çFf\|<*YuApkROH)6S8浮@E S J׿\i+ǧ-~>XY=1P٪[kP TGMْW!p|0{.ƍA-|7>xߓR;N8/hi󝿚++frEkaNr;!Yo|ZñbǛ&;`, 4,]iؓ;bygHkBr1BֳY8?Ɔx~"pb!˔i}z?7:+-'>~0+҅Ϥ:^ qġHSbr.3,f?q_I+-pJ] _Jm `JNaFRZ~N}"iʆuҧyMC-#ZnOeڂAȓMfWɦIM<+Zᛙ)SP|pUޘ ҧVc$SZ~2U!]vڀXnhuG'l85T䰹Kڅ^#>}JyK7-4Keu }'CT:qZƆtIQfI r=^'2c' pc؂2˶bpHc`Ѓ9%Nà#F'¹IqKwg]nqRPS\::13|WzgGҐ)ҹ\``ڜ4ΡMƒzmTnt]ʉuEH2 dKn@7(8>ryOW#+C]Ǿp1k#'lg"մ%!ٜ j)0H9Q/[C F5G¨ jF6-EˤٲVXvdSY6)0ofnےǍ; E5o oxpzd@GSً%ljᷦKJ 7=7ϧcjIUL5Δ2<`p^K7#ԁRGJevcImO*D =zf>QnV2bhSY~5Ȟiˑb6c'|N`wvd&?Fcd9P tmR'cFȭ%$q? n.?+'PS(؂(0u|6^q!hM0 , gp*iȮEM0R a5ĤLB0;1],U^Yf"+  tUXUQ}(]|(,-#îd`4>'Ֆ [vjguxi֙e/Ubw>yɵA3=Jt_bydHP{}u'@A[ o(ʔpO2JIJ3NŞX< -^$z62iq}YX`|拟X<8w@\K~Dϼ? a-"%R0Ǫ_Ξ_{yӉYSŸvW+q2T˜b1j. uŮ݉3o00ĜiAqLE=.{mMYI۶U(O忛v\ԵBe+h UN}/ޛK Nk2=ȯ'ޡ OX7kRB>Tܟhr=7qeXZE^'p:QƽdնWP7 H'|됖ri^E$Tڸ.hD47LQ*ERr$# c־r5Mh5QBw`gB A5h䨤pO G޸&W }?~@?2AZSMLHy7E? ^Կwqs9[iTW>5qy"Mt1q=uȾhfiZ$hՁ ]#-urȵb2`wv;oD[놖ݎL جr  |6ȇc$dY䚉v Ӧ1ȴȖQ.`~Myn~tߨyw8M< i6F]zg#k"7V*2e4\ V2Km.x5Vrڴ;gS$^jE o|",E$-R N< "v/EZ>'VjP|5=Fb\(zlP컱_}<9Q@w߮ Ric%t=14(>.jUSԟZcdsz/Bv>;Ej? SxzB:p)?1uB4L#mPOz7sJ]G'pl{q; *VG])lMȩ]ڧ !/:*jxX4^%UTSnzMu0҄,4av"$w>3)c"]>9R5Sas,gY@8Zt%G!NY.M<aOCUPs\6b,>(ǵpL *^3.ŏ5O_SMFUd߉2ʛ*>61'*++92|J'l'&:}jʎ,:sXE>fdK 2"Q!&NΉoO).=AFP] £;Fq^+H73DZ9մ)-UZ\aP4GL,:q'yM T^:ߗԁS~YviRD(Gɯb zf W!û-4K{fCU`&2=F+Y(l2?X?*<- HVZm!phC P0>]@&?C4XnPU<7< No>h:v=p0kK< ]K3c8yr9w D84Y+x˷FdIіf@A[F{mJo(Ԋ)5nޝeO3cF-B`Jۨ2rb,ww-$h6]D빭s&Su.RڿLi-!C#m'PF(dƸ_3 I %s\DZiLMA&$R=)mMa*(bU5WksQ\ [ QCAӾH1(8#J62ġ7\P:fMT_HE ~Gl07ޣ,;86 Mt5l@r2 4(Z(*T;9af<;a.yy>|{ qgj˳Ӡ"E;d0ډIQխJ gW QNJD:v:;jN=68oHL~Cku opُJ8:۾t-$Is]3oAó9Ig *+֧ms!O*h'4JAi_Հ[1*w~xnL/w~Myu9Hb;^%׮cSZC TJl6 u' ";hkMwro ٽz\ػҠ=v\QaN%-cprU#ܰ.1G {R=)GO*ecҒOUxי6tTqU7WR?K3+EmG>q]Az{̺$ZSN~9œp,ý׬u;Y~PM;Togְy#ԃL1aD/~~ߚξ9Uޣ< M)eo2+uÊ3Ҡ%]5IviW|4]䛗|,Id:yiZ>F6 '8{_Kԥ|1C ?UˆÏwYAi ;K;(ޔx xvp"M 0 vqr,QhȔ""#ɰ5STu̘TW>}9(қmieGqZzJR@$v=M 9.!}? >Wo.҅Z#3A;z!wqρi_-b-D.iFD T(ž>xNċG"mSpo b^D9c`I'jl{ LQG3:7q6EĀ06"Yps]ghzWb}V,`T ebVvĀ=i֤ق5d>r^d O_H;VH^P5jR(z,m+ڵ~S1! 5޵T//-RjjE6޽jE~d R4]d^Gr*v4߽~[dfD!$YT1 lǦ=kӽ-)Z,MJ8ipX! ]V8`S:QKo v IvCnAf%EF Lww;?EьV i(.#P+AvP耊 $sG' j o_:V~*v[SuJӶHj]5'&=FW觸̨.4_,~hQ5+KVkRg^.0cWW4Ǘ.t ]P GFT{D8Kݿ$m}ތ;8Fo5;W1H~y/U-~JKZn>Ү&GʨG~h5WUTMI:%!jEvr~~Dzרʤt5-UB8ރoS2.Rٖ(-)ƠtQfNl#Y]>QL}FUt!i՗u [[3r.gu& 8º7|mJңu5TeqWInqQu'~$ ]srmf^i`s( pH{j$džFeZ4y1w2q>eH.{ g#E} CFDN5I ]" xnXP)p5"YmPzm+lPL@JͰʵO1C-t/h*ul[ćߘz nE=~x&SP'pkvWiBUI!@kXOu]Um#<ˢ:e5*R~<,ǧ ?<Sik4EJAu̎@"Lq[~7[ t/Z?i,ُ:;bd #cC\(=b,PZyOl7 x\cho)-~ą$W 2Zb {e$[db}E(1[|dUӹ 2YzuvJ,K^2ZeEߜ60+pIyF8xfLtĸ95<\J8NT¿GL[hۯ͆<".&Sxk/)hi)һ/N %ԥ<&EO߈}w{V:i\yh/N۞@)ݾ C,=zsbvQVTE*Ok}&k[ԟnYjV+*Mƽsƚ0؜ȷU4,#/W]~팶vi)ؚ& g(4jVҼG;4Rft+l䢹@]E(Q@02LPeoro?̭vIYID޼Q[a NM!JV8gI A5CSb:}.LBN{Q7nDNedrhרYPݶ$Kj~)߽ծ"4'c!Tz7Eh:%v=hiAGl (թ* zq>>MS͍,㧎p=cjW\3! 9GRv,Hr4<+{dF%Eh>g8:@ЩۥG_ݻMØ?TNRVH@r*Mω_~K:pv 9td3SȾfͺ5nx\r[v 0ƙCPS$HdX;Z`k! q‡c]ۮ۲Ʌva j"\Bܜrq=Mk$KmYm [1ѲU9GEO|NN6?_]ܺDwޟ:cL5͔b),dH]xȆa{`vh@2T,+O㖀ĔڄPSiN?2k K{G:$zyڻ45z>ƒ}oFy<[oJᕩנ|ZBvX+9x|qCGc[Ҭbi dh}s7_8X2K q 0^_zېD@Zi;;O I b lwz.xa҂,<#p:ʖ`d}Oηk|nA6X2 Gߑ .~Vaָb$SLFcDPToub7#o.d':]>]91J,4W**kހS/Fp)Ğ$Pһ~#OOj.N#*DTu![yV]ܭt)bv~VijO(OёصژҽV%dIGf ץH #I`1d"<X T0EzVPjU2%ZHxW(Dljvm3o|TϞ>f[L8Y=q ۥaz\( ^RzJ*&ݾ3tzBTsوfΝ  r1hFt&PW68 t&Ub϶cI 1'2u>-l&/p2[W 7=uRP3e%r |?l"njv72:"d%#"КFrGPR͸/MKcPzw=)$QF̷ `kg5?vйuƚyoFDGOzcuv>݇bǼ0E2=41i݇XXx'~0T$8Р8kMjg3},r2'lWm፟ncKr-P7!K2;-&Y"R)g|ɨr3mO6H4s#@9Wl6r#B%*| A+ 5kFma]Xq=(e ٟ4&iAG݇Vi7Z~YsqcږVCjOC׮s?:pD'xf]9n#?9| xĢY} zѫֵClս2Y:y%qR X&L iVe~8˂$T*kG-R=aT`FbT`dw pc ]p6R|s0ĥ+͟ x_՚j[9QM+jF>aKڧGT ǧ.&37j~a˼"['SyVLN^{aN;CksĀ msWD;68|8ZP P64?;&J3 9؏'Ğ~ǸvkjzWkz\ Ӧ^=[$oojoVSIݍGMa"r kw3 kK?^裥U#3>`Tg?@KU%(;!7f?~OrƘ6ᣍI iW+ElMr 5"DB!2ּ ӿjVU6t93J% FZ=iS҂nh &0\6|b tM7ߥ)AkS4ٽᔖ=q#3zl8˶<aCsHw`A;uDbin h~?/If>{fC8Tu ),ؒ{Ypq"7: k|MF:Ov6Bz↠u?g&!i|-ws&_wh>Aǐ=7vZgo5 h@5TL[` DċKgČCp3Nʃ : Ύ_tzL¯˛MZIfӦeRą'nKl+[sF'B|N|nҧMt딚)YYMkQ\ީ=+C\$8YF$n\i`Wl[o  Ǜ?9״) -ky/瞸]/B0}ѣpJYۣxOgyQ}cZo M#]$ƌĚҵ>>%x^J V\^Ҁ# ̇e;ԏLK rąPhhk:{o/ڔ8xhhzm>ꥁ'#L $R:.6cCC*z )@ uezHIMB;J.$"rw=Azw1]6"T05R;Sko M#b9lpZ bV $Ǽ qêޣ gmPK9cܫ>lTyGNUfOӻ>,,tL_5ϒHƜU'rm>jmnS, tɵc۲î v$\݉;RUcNn( .LL7@;ϑ5b Sc䍻kH;Z|,AM>rJ=~TrYx_0)OQڧ  hzY AlɒFFT^bSjg+r YZS̀?3l-OMVx's#w_R*9z~0΄xcc};[Kmo7ܬq1QuW>A?Rju!~>3"V}HtWItSmIRE+R;u$HY1orGV`էxIWp8ɄkV\ȑ$v|}+^;vPjf^dN*ʴkso6[5=_NR#BV:U"`FH zӭ~ 4mOe vww`nu SJQVw43͞|ͤn6$so!6O#&:.|vK[<$M#~Uۦ0dʭƋ'gzEUwKBO: LǔNp8D+b^[gAR @Vwl=c?EoN-W9VT0q؏qчGfG$CL.Ƌ=4JicE-]rrty `X7Bt#R"*ǒ?8t+!ۯ_2%}[j<7 j:OQ@ +ӶDl>_1ۙR{d˺Up)堫?4o|kGcFg=d *6".HޙN,[x,#4h%@v1ΞG[rxpz"N&54DmAe;vyV)A WzexS;oƏmIxgD¤Pg@]k5rwx$@n A)hfkާ12.)Ռ:d( x~9mB5ft;sk .;>IcAg8盙5g+׮x[Qn^/ma=Fu0'>8Y U d*16OW=z₪!=6&VO|IgJSUOs^+$>5ܡFP1XP˝ +ñቑq˄n r ɧ[FSu=bbnΓ5>΅%W~_~s&}h #,}yn4+Ѐ+]OpM[[voo#}+O76R30A"Glw%JԀPM'- } ===e {`M7_9lxN~k꺻ݹ$A3yS,8t/=+պ[uF R +󭌒p h+-tɵԅX9m]SGR{ws(ö?8d!RAP'ZT]ۦSq>hZ1V(iӁ0ɱeF<QQ}DzLJ4:ѻ v&wx_~^$jڽ sT"T&O" (hHXE@Ȓ^XݾgQKx%B&h;zvS se8G"oobEidZx6l&CўZR ~aj= nK4b`d{}H-Mug^s$9_kCxC{x⑸ ;}1;eJA#j5)&؃0EQd|4D{̗15 ҂:ը鿶(ێwD Mz4,:{^ UN|GsvMVw2@0P~|i,@^g71&Cq޽dO~5^{q*hzO9 ! 55"aW[!x=MbAzO* 7 js SӥGӍ[ZDqz׉u\9JR|ih>dŋP6 RIޞ=}~pyJ?2i(R}dqqsf"\=v~rg+yeit$wυߚ]\P,r/QRmCp"#L#A(v즓Vָ݉ٺberP]$@lj|1drnF9Rpq3%.Ҽsp?v@& q4L~\W_^ HA'1'7>iwe#TX sL-BD`G,F'WEuQAY{s1xD$.$7s/5w'lXr[A6D@`jtkbcNT6HuO* ~˒|C v۽v0BAI'p@>=ɑK؊ 2&\J02؊  :Gmf7g /O玕5-S`3Yv| *nMMcrp^eJ09oqVEqѳQ)xvs_nN~aҭTJZ͹Z7Ғy>&lE6%L -ԒMO넺+m;t.9O͂mQJ9 ]&n pJqF:?#-dAZq֥aglѷҟZ*AOޣxJ>'瘃wy?v#tӠiEG=zH&4svu**0}Յ_:dHoTP!Rq| jKz$mPx U=ɥ#P)0H6n|l(2hըrJ3:fa?W?0 m;lu1=DhzN qݼh|ߔ؄%*ن;w&L=LɎ ׮Lnxqޔقu _P0k+ƒ 駉$|FֿoY8rv6AFN% y,~o'~Aڇߞ}۾^ w2do({VVXy`3oQMbCrio$+˟>f:}SArg~כƣ֟Muځ(r}a(A9 >\E$wtO6u/ޯ;BS#ʐpn݂T^WJBߩc OјӃqh{q9PUEZ`IFxI7qrxeuYV;=l!>s'iZ?G v¤֣Uv9x RI #A?.d%LzP JwZ~XRK+:4$˵M]N4؊S|\]ϝm7 bj(O|6T km޽yXQ7#!f'ݺ;st(TZ2m<=7Zf,8KcCR\H}*kM2nCՈ@aҝ5 ^X?OL@zpҪR3!ni 0Ш>1trp}8Ԝd)6SPMN"9,blAKHFRImUR疊wminM0I)=+m6iC-@Lj.3KvW:P8DPs:q>'7ek^%kӸ闉Nͱ OT!~bivOjBEΎ.׵䙔 jJxd}0K,{N+׿;ᕲ*hi!,j>j70j )Sz`ѝi\0wcآr#msdjm$[6 lcUSr+]0@);fDeMSdv?I QRwL*$A,c ;w$~!S4$WS!QoJSl"\pa[=% ?*6ߦ}ԅ n>3Y4~/0NCq2ԯq_1] ~cJ).{Ёס޸nt;յUPT$;TtjdykCס q27&dHWAAۡ=2թ!-k rFw'#}LZʵA;o_ɷ2i(iױx\#zu3im70'a)M;V=rc( +;ҽhR1)Ÿʻ;{b] N(.)peY?-DIv ]:Rwp`&$|w=8Oё2%i+o{ttִʋՀΛMgRd)dau&An*Ih>~t$a)Co!&̪ n=C6NKqsNBAF>]!o4?OQsSN~zBUT(*.6yOp~qiWZiȑ4nZW$B/O.xT-%rBʼnw|*(XRzn[t%3T!JW=n٭2+x-٩6l,{xW\AƠ%f L=+cFSM:v/mM4;t*Dڈ^ң~5:=v[ i?3+S!ZW`vߦmaV\KYA2(>yUoSM f&|bLu{ߗ(0\Ȁ,Hᒭ?OxCZN`KeNWԮŠ(c_|hx*cMp]+|}tgٷw;ǵ1֧3^RAI3g43MG-Wr#"o30h"xǷ=F( "]řv ~zm2pW\7.N,>sҖX╩Tv_~ix}ُP~QQ(929IZ36phȊ_ydHjLifxYG):ѴJA&ӓa4rS!m mΰMMzz+]N=}՗Mo1y򷌲Ȇq ҳΏu9{>E_Y% q vN9ȵNom3@k N[o@S(gG>s_XCx |Fujh^׵ZB ҤLNة Aoy[Q,0;ۜRHCwgio!I"V 1O;ԵkRqi @mjKyv3i@irCКmp{CxL\K0 p6lHv#1}2Bnt12_^+(|qDo2][vR)-X -plPa# 1\y/0-n´, #gG z=|yc}nTBNz:t~p8O_lMdP"f륈&^V9R/b>~|2w/:Hn#Wyv&!_,Ė;2"7xu;v~^o9?GvGj`ug;w ! ~pbNkpݤW4=[8~D\ZY; Ƕ1h]H޻@6 ۈ%u"”zU^Dc!Ό*_0]+DPGƂ)'j->!#Zֵ' QHl2M#ahw2]+y2rrG^v>%V_Ć&Eַ̮)ԀkZv/*Ghfxbņ4}F7&7ߚب`)3ŤWWs5h@xmc#wzNw?0m qj8=X y3,R}lh"sX_)ᛍ9o9ߙUG=4s;k"[`%׼e+i!v5Myc6]_R-KCܡ(J{{?$ֺ!ޤ#͈5]OEQşfoo;; j$Jm\W !e )ɉ ~Yj q AgwjLTrx m旚/m~YG,$ ϫ,5zt w QK)Q#݂߯dЍz|21I44Y*ִ>lQh@{nP+Rjvii8NIoM5x@+UN.cA1[6<ڴmW"UEiWP܅Ak |~X]u9pE;fղmN[R CJow9Ϙai.e ҕ4,]6OqoV [UH?ކ/"ty HnG=!oo& 6%TqG[AYI]#)+G!悜A`<:>YвKw]9ˣ|80)4&+_Χe4rr_>YŨiy?71o-0kbIꦃǮy>tx'U:o_j9Wۢ_Ǚf~V'CL?ZYCr$E2B$ω _^ikr>?^]FqUVarq=C+Oʫjz&Mil~{Q` }lKJ)"z9Q%kJW"k,J8̄sgVNtë o2Q>^K&(//?ZM} n@H4{D`gu⻃{Îu'~+5oњ<ӷpl懧2XЏ7XQ|//hPYxgN%n,#$ubbM04XwJnrg2!@ (<^ɬNGґm =Hbw`fwm wqhabAS ˒lcl?ZսP E)C-r<ܱ=h|qVU`9m] 0ZJ&ݾ_Nțx)ZRd T|8SISzg"jxr0H~&/L4xzɮae!{Rwh {0IJBَlPizִY8Ÿ}Uw?K?:\>K9 W=E F[(uvOSekN!rߙ9|#,o]U P2ץ|sۍ>B!>9w.X!嶝9@/6Yc޹QpytfKe 3Twj7\iO$Ώ+8 5҃ L@ߛFE"cћOr6 [n̎K)M ҽQEul7)^cYiG(]WwATRWɍU^u,.UyZ S#+RUH~qs22t35aq2"Ȏy%=p3NMd LH_ϫz̒C%Vɰ/9.Z҂8N~Y)5;4Sp_Tot=^x'ĐAo"+Հ,Q ˿j+|\y@U#+0V~hdZ#_hL\_| ȩőr殺jҷΕ*XmQ[ yi,K)txk&g/'|/Bȍ=G^fq,EZ뉅*̠n|iiAQ0FcS}zVbeyHڽ),v~SnI I5q;*Sޘxya-'>(*i_zqGljƖgMjZ *:'c (jrc>fظ/<[z tWkYs)Kco^0iMLZ_+FPvYv>pqQuڌ7"_c'T&XNJ7v~XU P ^c2X*kЍ3ߘo`Uh_Nԕtla"pq92F@w\Vu)_Q)H|*dJ+/N W2O'4g76y'_y4cA$d<̟<҄߇H@9_5'/Ǫk;)4}a]a3Y<|EFMeKoS+R\nуLd%{;OO?] Ivxg :~}#R9/F?K\tx+"mBNwU<2jU@ɮ&TNl3;s7 3,ΐ- .<<"j~kdͺ%Ej+|+!ݚNF uѐ?)whċN ]QFAVƙ5od E~`'/w)ۦ{ ^'C{ z3~\DRPT :Wǹۦ SVIKpy5O(޻J2 -*: v88އourYڢɨ rkW`Z7?G|Sauqs`"xI5${7=>p^$ّa7ZI' j޽mu Q*_cL6piߟrHn Df%5 'pg.VHnP9+=F/˻͋gRWA:TajP^(7VCa5E yWצQ[-ZXјY6S<{bLP@̞ Ƈ7raN;ҿ<;\pz^[VN_pVޞ^Do\Say 4oP }K-܀>9qrIן6%aUfog_*9xr98gqVG)4Ho,:<)}dejjhqGF2@˽CB2k4sJr%R~^=R)G&(v* Mܻ؞"0ty{/#9w)*YQ] vJc +eE}'S^dl,t)򆸷*^)tazՇ|.gEw4FNDȏ/j>lw]4FB̎n3.&MOVk{+J,JOqƘ5&q-n_.kQR9=[V-dM?Pz2%l뮌h=2f,xZ=|)**;+- nJ GL_hs. E%ҧhPr˔+d%.N4Oo#{NfՠEVļ\Pd^6Zs1 m]@\z|Q5<" ۔r;0C-?V@Džʖ[ _8[1@}lx,du QVF{SU-|0[%P BE'[~;gJHJ_㍓Yn*I”Io+D]A$w\ʬ*rM!j{q4n)|ʤƃ_E$w"1|M~HJj{zHH S bd!mۋdFY[U'o#ڿࠑFgؽ{ȿrZG  6'<1Pv9wuXQՁ3`wO_ӌ{g<`WzxfFہ>!zH?R3N7bN!{$TSn_r3( ¿F_H/-nt>g5kБ{qҝL|"'%8?6ugyh 7YTEbfs5cƃp4#Ji\R^O83hq%P0jo^=>Rl}ܨƟ"7- M{I@2 ^;xOY:n;$/چr4O.IW3#]o(V%nWbAr u=Fƹ#؎շ;ڳJ R|9'[(*)=r*uO9^leF?(|}]0dg_ˍ-X gS'G;t4p AӦCj;1ِNjZ#a'O|mN!B'Λ f,ȁW淟Khm$XmMm\Cild0ʟǓnˊENF?TbI;fF=F>r7zJO4F LbόN!便aޟMhtm!tu5fK"ʾ{܏BE?9Ƹ vs&䝗1r'm#g%}&Ui^".|1w+3Uҟ:x綣IiV(#gf}HےӉ;t` HWc0![Ȫƃ b*O:ddXݓFōHXs$#5xQEI~FoS4g{xlG3QwN,hV b(5ri$R䐇:xle?T]zL&FcI @y?M8IJ[i@< C1u| .$Zm9,wR.Qt7S*]+@w5sQ~Hlk{eD(FH>AojXSÐoכ[5 OM~?d0Lƙ9Cփdl-;٨B2M{[+ |+u(q:6?)*+<9S5 Nۏ.o]A&.O>k%VZ%~׏;M OڻUN/gp/8e//+'* îG-u`||Nj:r~Eky(r)ހviĂ 6۵FHD/sa kWxB|qQ@=$m LI0]J&$۽T ;txNZ|Hǒdw'A8ރգ%Z'A05?zxuěT7i N? )ڕ=+W@HHN?V_WeQ0[L[o+\Rv@s~2 !VGKT5@IJWU'do"nD֝kaB⵭~Ų!"z(iJ|Z>ImdlSCvZT)7wCU&o3Iee4@}^E/&i<-閩h:>Tv֞n6r(j^P0$F;t{$XUĮw];WDQ_ gs;޸"vq7lD2 5}Jm1bqdYf!=S\˔;f6v])Ob $ޝ:fHٕ0p>zĉ,@B 0?IQgy}u{[0 0 *IOyzv̫zm={q؛5@| sZsj.C!RbZ xW}CG _ P]7XPd6DӳC]6cFQ((KE;gt, ӑ+لv.  Ϥ q s"Ɛ܉XwEcs+LZzd ҫpJ]V+oCly_Xi'FQno9`gZznX$B>XHy˛{U?jaѬ-@(F)r{N{%A8Sjh:SaW 1n?Lu=U9L!iܪ#r6c-W w׵)}5י(ǧD?/Q:bNGtr?eAL⎒( hڣ/MrX^e+o' iEb܊po͝@J1ڃǾ~X 8 sqʋ.XRsUp+zx :%z5;\y~Wmɦ%BQmJoF`IܖZȎ#ByfRwKY:/?8줟W1b8)&* ẉ2.῅X9IUIS +}My!ɴ&3o}^OJPT)E~U򥬏_EIdECr@<~ ? L8J6tstZ4닶lol5?0ekjŁ5i:S_~V\Jh)Z5B!c /<7R;Ҟ15zTwݛcvbd3:[X๛bhđs̭jW}{2%՝$a1qzų8yM+sAJ*PP6ΰWR$H: C`j+kr^3bHD$ڈ%Ej2Ir^ ?`fvZ|&Ehu/% Z}|Y#6nhz|z~K_] [>PH5#>=PlfIY>3mL< wuQa!0r|U' (ǮSW) j z›<|^X  7xoH;Q\rO1ωؚDaDڈ}QP~sOMYidp~w 8Kcqn>6#&Jl M߽3_r.U೷ :oLǓꆤ0IJ3*w;tG4KoB{R!ɧpi%:fֿ+ojΔ?a߾nzS1;Rio՗ qiWZm!;Ӷv\$}cZlr)$SFx0H7Y ĎAX d)އ5>8Mo]U~%%vj|_iSrؔPrKq~ 'J)oŌ(QmxlA$0)RO!mZWo,蒋ljwiE{[qrΙ^H4A,i=HJOᘃ9@ ڿ!ZOz҆0 5ĊW&UjI>V cyE0)#~bߋ]8RweNS~$g ГSs[T׷|e(wu~'7voE!Aw;װ//9"xf>93&!ayy.nC@X)fKiFlmEr.ݲ uY%Zf?jUԬFMr<ˡwYV"ooNдEnh6"d原)y0:wˡ6ҕf_l&rұ^3XHֵ; A_l@M*iMGB~3Rb4Kp\ z@qx*j@߷Fg0Kw?Olzvvߐ8F;s5a% wx׍i"9݇]yJS\4-uB.? :m\g5HڠWc֕d<;ڒЇVKoM׾BSM-^ vnԡ:@FM;hHԠ7g2`qٷw6_@X򽷉zzm< |ISµb3b`md̠<#G#͈ur1#oj6fBE{e7l)؄}۲N4dL12wYL ir5X;31i2Tn:dz1v2fJ& u4<<m)̰mg@3nWd 9oRR * F_A& X<yJC!jT(QZ41YڥZJC˞Eu3HE e0G |m,dB nyt-B:ݹ/ђSZ1?'|(k+!A̲'Gl=.-nU*˰OX4<\;XPJXS_՞Ӯ$<ĞؘɾaMn)s۷  lیG\n#Ut#ų˿0algx? "MϢ̐|`%p~}y"6c PIlvfMm/!LX@W:ǔm>f w%cR6|$2p/O1I""Ydmf,ChwMΣ"Nh{Sy.X4,v;f~`l52ߞE CFkdDf;bLô_?T^` xT"ZTfC,yz CCQ^,z 'f|3$:p|oa+zROSi&yN] a= ..M_ ϡ 򟪣 }M  û˭9 #[X^B@=*uL5d S2?O*xmǔ.utEf`hXi|~5ͼI"gw޾EtN J~X S Oёjڅ~6pAm`á[\2&z8'>q45g0=|*paXgB.7eɓr%Mޞ5ȭƈW7'i3t5`85+OǦ#khs>шnQnTvWdTw4TC Xo=q鿎h"牗Wiy Pucb@_ɐ XV=j~v2em9># dLz*/E']7psebfp$/f~y1O/,)u04NđۯŅbJƆ8Wb}~DoB:_Ztp- Ft7wó4Ob6uCzt;f+ץ8v6-_TuiiOϛRhY&liL›،IA4έGNe&61M5%zf+Du>*;|9"ǂ]0#ǾRqɑfϟZ>.U$jHkF*;L\sw&0h٨x4B;O3YIo, ׎`e>.I15'ؿNw4dOqogΟ̟[dymˡ'p+!c4]rr~XPy*)-5c)+WgRؖai3+]FyA2!FqqVz)B9%0co'mp镙a-lpکT'̜q$prMg[JsO Όik=䒚ܝt d'v)NɎ̎#\9;=!ZrclvP6#T_y/[anfØ:y˱K@SCHHy{Sf*@” &?>Ky zgX:*6AϛIn.BoQa27SrfDT\a=(OOlMzY,Nhު;tAw|Bhs]Ɵ4kݽ)EmĒ{?~NSmA^sUn=O5Q`+^I-4N$ ;֧+NOP⦔4! qQ޶xlz|$Wf43.0j%[ Ҕ|ΤOlȀEunP(#`:REzn^Ĕo UJubޞ'fBWOq_oĒ+MMHS⠟ В}#jSW hpT,aʴ""F<.:d-mEg4"#>TCC5rg{;m^9jgҧsK:Fy]_ [LLJ[Q2as\CPLj3Y\A'&)!ZS$ZF!Ssjt杩.dnSQm*)-sb*xOmW?qy!_iEא=y\;%KƵ0梃'J* i"'k`? njw?|㟛V5qփz{>- }/.=gu'`Af}SP>׷J]q_Y9Ds| %:ՐD"3(80&S\ *\v[Et 2KV)6\`T ą<}jZ%SA\(o+~`Y2vǿԼѹn)۶X 6kc!ZJN Njʆ^&/?5//Jg=XwV;nf sdC/v꾌A[\PJֹI6Rgu` - mQ"So n ,m½;s2jCf@'. TKB":>$ Zv-AnD,Oz72=v.& ޙ.7.0RO#`)Ȩ$ X 44R_bNLsȮ-`fXX)Fքѫ@ݬ$$-~4&aվJ6/$+F +@)"Øq5:qQa/u\ M`+OFm4߁s}񇒖{nt(sDV8ӷF|;;6+iuc/bΑ4jSc_mG[/٨yw*,@34SU;r5fo!!Ct{ٖ8A$|ϾqhRASJg[룄H}'#6$77l~*Н g5y$j1'ma7 <(~^ NJ"PUTn)!{$('*lHQv-~}jZY@ns7x g:F6q;Ш랍9D~cD&'ΞvMDF榜A9/~si:nM9 yOJ&{7pJucqmjn:HҠ0\Ɏ|}υ|8" P@^$lAg'`VZ?,1?1|{OGD0IPNMsyqKAh!PƧ?Nbv2s(uReYԃAoSihh,G3p1r3ʟE"uHb$I*sj(``>GWD|~skYI9yF Ri|RuYZE*݈9ȵ&#S-)LDz0gXY-] ~v=[W]啂nqc /QxNrgnBPY`O6HE/.GvH4AkJߣyX(䦻ta8G]0~yr:VQp X~᷍2yeT|p%>'>pmv6 'aPMG161*i/+=T9;k|1t>527&v4,MS#Z(T"OZ}h+4JֽBqÿ' < tTJკ[_նK{袊HѤn754>6SQc$Iԟ x'1|Fdn8NkPX<7{96p-픗*YiEؐqkic4~+5R8QE ir%g OTy(ޛtT~ʠH-rߛBM }9{#˭mJwrY(M20Z4 VʕW4L%rekHa]<0=܏|:e,6y$F*WmY<$Dfܚvr[-iBkM+QA4)Zj 4F#tJ֢ rpӬ8F&h{Λp\p;5Y l,SJ 2Mڻ>"ӴS+Sŕj!d62ƭ鿍;|W 4zY?8p/ow'^,[V;\Ӝ.W -"J4%b :v#5ٵNn<5͌jfBO3~h}Z6AS|{/ Gj͹>} PIdڠ<j];$Cg|k[[‘p7*G9$5;8XtgEZ(xvq_0Mm= s//h9(;&Bc' d %.".{Jar]JIFi ,8|sҽpi͞ĜG*۞cᇕ޲ urv +\ovɲj : t$sڸϔkC3}EdKJZVŤ޵ ?Yx#OZS=y~k|s>m!1m &7ӂG_)T3'kGkoϲ5"H"5GQR녯P`=|^Q,ԴyR`ʳgLGVkp" ueRA>񒿎~Ao@R'2fΤw<{Ϳ mks>Yk|EO?JA:ȌuOYr*H'ZZ1?#o%Q'Paj?wшK9_ #co> "6sI ym˄Y MtM}յz|:l9=,S?'0Ay,?~?_F5lq'ohǒ ϳu*yێ1P7;: T1Qܻ~V`H[U?,EAlzo$1$;ϱuA_>ۂ:6*mkL`8@ԑRkC4(CѮ>ߑ4C+rC4&321f- qˈ#o J vH>da8mc=JH74"/o[$i%QP?X1Vʠ=Ϡ?3~l 4PGT´#-~ZH!Ϸ250PGͿvj!n ԆKv…οw6S/:ǖ!di~fIa@X0<dGCTҝA3oh/#c zI8=3J_iAӥc熓O$IT0In>c*&dsޜ*?SA?G0I}1À۱O_*iOe8'O"C+_J_K]ML+o觯Dw(\I?A+&2g|Qϭ?j%6~ `|?]tmQ[7)s,܂m$1>J+>W*ro 2~pO1Mr}+_J`#9bMwzdcWš$/=Iڄ[i[M;6j%G>zTm1`s9`)O'ϷIj>ԨAݶm2] x_G%TO֤-ڴ>? Lt؟cTp(Ȉ}#wnkS_я2z,O'ߧQOϸ&|RhO5%+f2eFw>ߣ\/=MITr6,}}*7P9{WQ2fXpGK}oR7 ~?CZWg2?<3Ț+Suoԃ1<:wRG/g|t.5R+O9|E)znKEzf$5Y}N࿳5kؓkjG 0R?5K}/Dž;+}/ǁ|`k/`^NɾtUū5;zƹQC_S1*=z_䭻X}R} ڕZ]݄{PWǟjTe[noMGs* Z:k 4K0Dj T#ߘ,N[0Pj(H֟=hpxk;8G9iQ tT^۟Sd@Gr|}q4eg l;ؔϤ }J{SrAk9k R9O+!C=ϗ^`@%[~^7K}Y*^~^hn($V`_1߷0ǟuBz} 0;T5 IT co['A#>g )Ԉ=ecvO_K(]z$~Aѭ?6mj^.K 4uq^"[[-X@Aoʭ7PnkyP^/R;!w.a.&H7]7T8O5|%?)fN ITK)SC؎\R[O/yD{??%EjH_#64G/SG%017m'}Za_wY<>q+`@}2i _runP-@@I%#(v5$ $o/?HeI`EX۽}57?tO% g=\ėM]x(k_Ojq~O\uX?ou?-Q)C[]eY;j=|!?K*r?;HH*5;-)O=?Kk<-!?bb(5KY}>ԎOǑ#s(zˏr;vCGkT3䃸p?nKr9of,IkTq3ߒLPS J{ri9?-mzddm?]/܀vͿ_-JV`_ڗ]24.^I~O=LulyBfb'+!*k:z>'u>tՖs#@3;t>?X ۂvybP >ec8j")[1#+O\ dY_D1Sm:z3mqfK6zg$#u h2%Oͷ'})Oy?Lrۯ͘%_ѕ'O2*ޤ$և-OMrGO%3jy-ck*t?طp<5H #HԐq$zݭ2(Y8?3<86ěm[Ri%Nt͋ rJf9!7GtԵ֗@q/sԀ|;,x-<Yajwy?!p+KOY'&:F}[NM?1d3o.CO"\t?O'?y}pNꤊc&O);ys0K/^hÓSםMO?"?ռK'"e,>;_ˋ>$7?xK-rw}k]DCrbB@z?/6x|g7zgTG鿢E)#罖~k/ ^U0G'OٞW~ Ď~g *q DnAYxmX6~bOqfz[W ȎH͞8%Jޟ)8W:+syfꢊd$)#CAJ.ÏGU~?։}hO|ƓLLȧ*{LN`K,ԡTpj`c)ph2EmI6) 'LQKIjGl6^4a4"T(va+'|jO1ȐIk"5Ҽ*SBj_8!M2X$ ֵ'*So)nKNG®|jIŎgDh!U^w`z(0"lmB[W߂@&\(qlޓapg`cؘ]:b~aU0ܫxBW1W+ekj~#ۍ69+ACf'lKqYwAq8l[nT'gx%Vp( :chVc]=nmiw,%pW )ѳ!B&6 MMkEWSou6 |yv}V4#፱cy#LZ&#IIfS"L̳[^֬!;?0[ܨ뉅dȥ3#௾6 ~'`՘d;.&?x Pr"'іu`U](b\*]qUo\UP/ӖNpO|L«*c65t#5,R Ĥ "rt Y*2xH8C*kal& d gi*e6:o]TثgmƵ_/T:6ɉ5Pܝ-h3B)ErAZ2LUAƑ* usb mW+v2(luͅFpm'lUIX8r)h$a bbtiPLaWci)T8q YK'R1q&o 'Zbѫ#V\Q `J&*\ lR+\%\YJST9ZPç|lvmi8 ,QyXUt.Ţ%NYNbMFܲ0wV&RA^; yR(qeI„UA)$AH1)}@WHfS|UlNFP-h0]@DiНGϧ`~F+p# /vi&cD|/  R!$1/$`[ezNv(ā`d`I>Y +\EzelhM5Tڪ1u#jv|k ru¨K˧L z&6k,gRBf4TXTdRN#LZ&(2?}I3&%(ڇF>NǨ4[bfƒ *=e5cmq|o] i[܅B Athh~wS B}j_|+kψˮXFmEku$FMhTN&櫫"(؜'CF8)k6ӯ0}H diz>> %tLmi:IAPkX2B̞8B6vkpN)rRJA eVTzLHsqx.IJAリ``(Ta  ,Q19:@ڼrG ֠n2,*@qBɭ.|hZ|H =RO^!&,R*a5,6 vXd֟jF& W11CGmBثUiTDm!k #& M%(Y TaJ(J'ZKTn|coMC狃`Q U]1W`y(qR2IrQ.$µ=7$`i`2|YJȐ.Pi!BB-joSf$p88M]MFS V#Ă;d~ɪ1;@#kh4ܢ ~I! į/RB`(Ŭm^F _KdDQ*- sAJ4̰Z;b݀c4=M`vөC+z\(p?A eĚ)m(m")H\H~E@Ɛ8 "*M(&M&HᕔXBlG^'V *3Tqv)TA\'9x C-Er=$L$N==>lU><& e:CW")$[*;e`Qkc~pW|qBGN549MYU071۰DW ABV$:Z jG^ :H0TMk>gҘfk,Kv!-Pr*1A a vt`2 mk;,<+DW(ncThp3L$"цAb0 F4qc"2p 5{Haa厠>ʧ g 0mcCh uI$ H ŎƄ0#ϱ˙yfpk*A=rAw ۶Ƕ\\R,qG4 T@sJ9i"ff mxi3Ԡ.j2L9\<(]T9s^0@56Q*уFX4CY%C>9!әЃl_pqy@[k3s@8CB.Qw`12>^V~4 vGpzuVܧı>g}"*[21(.OcgMw\8f *M|hzg[S`=88ae OZ,ml&6:++<ˆ)ƽ|?l'R Q e.+G=OO5FDEʍ:?宕^\}][#ÂUA_ _oft#! E{a$IW6] 0DA-ywcXnwII+짷9cR0ᑸ_K^ÆL76 gҟ<//:hZ {s>68 71j:g{Kڲ&MDBW^svvjyea n^è>-yŧ1e4bJ% ZҠiqbV.Wf~VoN`ÿU\N)_Osׇ~_Ҽ9SL??'Fjzyi%Ցm.%}$zhƵl7ae9V{uNK8:z,_➄{/ #CmoxLDϿտR)?_~< 2o'OSR|_Η?RG?x_Kƿkkm>xu h>{M4e)"W^J}kofWXHb?K}w,m#iZ{+0TԱz+?Rm*ZrASNK:,_q:_goUM 4UN6 >%$Fo~Hᔮ$)uxq̿q~X= `B&cEDI)fZr@Xkm?n -_7_;]{.ɡ}Qp#ּwQK z=9yE Zܫ *h= u0Y2"zc9HE ,PQwrܞpCKΚnZFVin~t)䔌tcG4~ I=_wCL#4Q$Tկ ,o!1Ee{jSՆBo }Ec{B̡/#_xOޞC`G6?Z,r!Y >~D>uՋAEk~_Ў@#%*]C.sn#=k.,fq ?kvd@"\y4$';8Z|7dѿ=F~_O9rzB9Y;xw{ppr#Gadu\D}O's;aV~IW#mTsjԱz3?S hT)O4;?u5_X# ctԉ%X/hVjײj7S@wU0௧{_c='D"k/= bbIFqWq7ߟ>SlyVR:Ҁf'>=Dp$1;ٔЏGc[DWp=G\_&Dj<ϬӷQOSSC/)j‡:Bߡy|?[d'f"ޞei੔ёe՗و~H.~~-J4)C.*U&-ophZ6 *Z_m/h0v? 崢vOؼN礗 r/'|6ۭAGCo=S-#`D ũN6wuzÓ+Oox R =su0 `BGC75m.E#1ZM-z1FS O9d<Ɍ`~'7Qb<48Y2mܶ4o;(~mn_0zIs$6m8F۝TSNxǵOdD^[#ЪB򿓣 į.USpN7?/v~Du T.1I9q@.TT}=|-fHOɖ1QnWϑuPa$qF$i%ޓmt2GG 9*AMgqTN6 <)) 55|?mjF 2NJ>]kv 4X)`o]}y%i*Ѹ緼K??ǘDfy:ZBxFٲ8cbnQ{=g{9=Hx"ym?;qt&E*~k,PծjяPP%_\ڝx}fGQ@j!b8'}=1cd?Zm&1-|Oy{̖F 0 hҎMU 0 }]1 e~6|UFGv}.|;ΞRnǫE>iս4{xe^P TL^Gˆ8$ !#y=ټyfRD@=ɑiSӯQgmW/NW}&iֿ'[URl_Η*9ioo2ybyg9f:(}].c x?iƟ,9Dd3z%HDRt{5e` A؂3_&8fG> .F\{o|ʽfLep:xY`@0@d@EF|ϟ_$8g)%ccp:R3.b}R4#I9=6#- E4SSмѦyPhn4rz2+R| n]4s.3!}qe~oyN/Ѿ,Q'-:՛ *ēAԓ.ifR2,șs/?pL66#gz+2Pe*˒#yfo;yD 彚K'C<kA7oh He2^KsN0q>eD́E9 _$jZ5nn'CpBFlԞy>U9a D\ɱ˿5#8qn]#gRjw7 \ebt#& Xr!vޛJϭ#1Uj[TQM\k/)R92_k:AH[մPU1u5Y6Qg{;r/_VsQG>y:`wdb~!3GGiDMw݁8 Ϡ=~{Cgo _?|yޯ/5}CU )s"+LWg= ?^j?T؊|,xfACG>-0rK/L~@{-!xGs冝+mI_GݞK#VSܫ$O*w-)}Q1 '_ix&?Ůajf)*#>]ͥ>HJ>3YXGp@ oȘ1x埝/l$1JĔ%YOb>(yFF}r9{#`h g>hvHNK]`ĝ짴闦 GR1!S?v|y/.yO-Ku,l|~h{3&i匂~<>}"ͥ W|m9_U74I?o>??^qpM3OTz4?p۬o77xd!u~#џk|yvzI_~b"\4m$a5+h;.z=(xu1 {~}LpΕ=?Y|-w`55P+%KEя~i?/?>OI7.{Gٞ }^c{q*ME$̣ϗ8#>ͪ+=1t o_zO_GҚ ?eg^dR[a4d~o@buS`j/eǏ!#2?UJQёq|kXKkV5"9>$)%4Vwo.mԭc;#*g'a0JqFC#sٺg2 ȞKsQTMBѦ@9Ђw{ayUϐ;>V.$N e4$ Xc|9DzH4a7`e/ 4!#>Zuo{Kg_Uc|G7Kb3]BᇼYE [YI$݉ffk2I'rIs?064@O#{1.,ҿQzWn!f'GscеCKY2BR'^DTҽ+ ;7lpRq3 S<&lGws-RWJ+FxQ?:z]Ukh'_Ry}HW?pZ_}SP,`.'<$vZƙ}6\xbqCbw>]^L9dOXޡL+Z׌3 bs?¹H_(%ES/p_8||bY="H^_x.#1*esΞg֟-Nky54fIG!t8nU<#9G27ri91F"$6ٔy;hv99e$TP>Ώ(~g]A4Lv@?fH{3M>\q `pkr`dAPfue5#CNt#y&wkfz$h>qEE>{N[ٽ1G?2{y=zL23RF}Jwr@gŸsxw7OoO?='j?fdKs'^WVz7=:閲l総I0-7QRl4ڽ\X/Cx3U@k2aP8FDg^YJ]KHx`s2ϺmbދQʬ/;BhsWx^toؑCSբė,l„GR33I٘4dX'baҀ6yJ^O^pQX?܊W\+ϛ;DGн\g^+;3j\@# @m$*#7$3}e|mVSJG0߹!\~'Մ}Q#יI/ȼMD΋\/?CfNyGN5kk+H̓1 HUG$ ٣&r4" Yyx@̀9C⍦t,G; >~X^%45#쀊OOgjϋ0~v[͐scivnѲ<~X@skF"1wyC"q($W/ND|g{̾i{[^yKs!{(x>vNIX">ݷeR-Z7UԞIN'܃ `*(nZ E$uU#V=;mPGm)'yKϾb.52rJO!cJ# Nu=٘{7ņ"1||˩'%?BRK4VSBӢ :ؾdx;>ˉ?lhoIv0}~f/9|J?sO<[꺽wqjw^]1y.ey;,ܜF DpI$d]yd,f?I.F9i=y*<;_??xv|@-k,l乸u(aFI(% 6H≔$I|L *:?}ҭ/[@,ˤhUP7$ &Y>Hd$$OC"&LOD@Ĩ>>ϲ?LwYW'W韾?qV%k smzW7ybjjYUQRIRsɡeU:~gU0*`w,MiC9\hpˆYRsnb%򯽢_2K\Mu"L! 22kcdžq<%R'i76Yr#B$YRw )MY#DQouk Ϣ-:g3?1?>,a+jDRϢo'[P\-LK2'sCĻ,e2x]/lhHpqnɯ4 GJj%|nmf}/AjM ݞfhRޤsKPdCQӐ:h$YVM>O~N?G>Qqg^-G#/3=}t!۹WTӔ9\@}6݁n?,A,[gͿ6ԟ}#3X?xn&`nb?sQE8t롞$/ezL{^r:V( '*S-3'yi$2km5#<9_~w~o"epuOΈ:|lIu1QO12I[osغ,v1c#n{o;^5_TvZus䗛$X躗;6Bk*9ODHRZ@{82?G /a_'w$m8!_>+ SOg!|ܴ-׼ |+_ϵ_1W_&Hބgcp1<m[?83Ov}?,SXӁ>o仇ڶnl?/M/]BxSgȼW=8%)l;?q}_?3OW䗔6尛̶2\Ȑ"R鰭x&Ć eqn{Ytr {5o2<@@$?SCG"\HyGIז$hgjF$bz^j_&H琐Ark/ݙI orzy1z#\K ;$`WW_g?R7>?#_KR%-aϠߛYM_{k!Kr_)>j; HaO';_XTkMk˖D%P|3h?~[Klo }uWz n{3'hj`%^Է$ʾ$4-'LHʸ~ i֗t˿,V ,Ifē'ý-Dgry󍿕mX.`WUԵk}u!QZ3vIkxQW#lv^ H?ZGPwޛeqEqpDM "b[ơC`y;7S3xa1$Oq46>o'ݫEcld'g??4WbhdB;_l;#OG\8hoN٣#O-g F}^8?eա΃2݂:ws\??'TH״_G2+՘9=x(o?_V,H2oݺ/3y~a'fݿ܍9GF |3gdyk)"UqKF~ej{'~g?&#wHٽ29<_gt}7ӿ&Ϩ_,?e>kh\C~E^Ioio3N1T y: dPp}.Q;eM'סKHtaFֱL@g#tSóqG!Q_)jdA?҃Xodg."ƫ]Ky!8p!H7!Z֎w߫+"'y[̩Fԕ@sI#j?AU$֍Ҫ1>FsY'@B?C4+B9V ]L?*g4?_!`T'#*iItkX^0\Ԛ$r4}irc3Q"2 t'vGƇdȿy_y3_ܗ#Ov}I(uFGAffk 'ϓ?y!Ё;/@/O/|~$-[~Oi/9EDҢvjbxJz{k팻^F: i܏ ]y_L\p$*ȆU9b}8l0!s&>j [(_=;^t7q>-Ҍ͹)AlZg3pOk7-?"gm9vJ>J4Oe7;w^P5/SܼDz\> aFoz_ڄC>aqVQGʴX=gڟh1aN꙳B(Svg*sujKq7s89'}.Z\]$0'%CaFE*)ZbSN&c$'`HE{gfvu+m8eZ.8?,9%mYPE*sOaA=ieGf FizvU?r&ZNxgq@0km[q???c ? JG9no'M`3B?vo4E/W_<9?_u~_;2>zPb~Qy6@!F} {g{Aذ"j6-Y27mnZmƓSuau{o+hJFxsQlKP>G%NA1Jȭ'Hmπ&} )g'sԟDza6ztGQF*}+n?QZɹT>1b3iAG36|W UK2g|%tG[P,5[9L>u&=Nltj{JwϞAoj04y: y(s0`exh3>/Qz58$~!$\?>M[+H/ˈfxQxZfxe~8U(UzKr6#]v{zr0X8~N:N Rm.Dcqld`kʪ =kR?k8o; 'U)m1-C; ]\2QQʗ{ekX4wsWwP6}NsQ>8o;c%<:!4wGO8 stlt 5 e`QЂ  9\H,Qly H1=.eh؂e45 ՞JkyJ򎥨ϩ麀%K2l+VPKaV)y*@-PNۦw}.$蚄 mZ8ajJOo3H#Y^HX#2wLu2$O!K0Qejg=yno?7N_?|~\ȑB4#Vrla 꽧9E?J~S=q(9LV[??uPy?a4^o!#|/*pk\%G94pq*H z)8u9! [C]=TjdbHnAkR`A9[ey?ˆU|ymbNJ'|D;K̢fEt5󗔵?!k=:wzٔVe=ԃc5blf0$>?r>ogp\43O<[xTiq#ZͣjMKz/X\{S]|6C.3 Y>vfq8_wEv8[8FTM:u=nVEiFi>n.!y6Dj䱞.d>Q~62Ig7^)cn+_z`h6<cGK]Y%3/.{Sl݃&|onK/-G#/3_g͏tGi&sg;m64.ie?r i ,+`Z0b{v 흷8bԁrT}M@xZc͍ʂi 9Wyi @IhH BWe/nX壙g'`>Eڍ "R=dcZ(I),:FG|{x Fowg5ܽ8 ʂNJ$NQM<)xOA6\ lEIRJYIVV B=_ f.yl*~Gll?*Ɯ G hԾO\܇Z\seg3}!͔bh>|P~%;(vI)'e'5ݣOKoqݟM7Km_O[+;ϸ ڸO$g_j~lSοezw7ybϷSj\S-"`mfTpr(vp枰#)c%xn.)oN׵;<{+qW $\9żd_?^N[o/ZT$V:@bAj*Eh3W#K5 P3&@:EZLB@5P3懙:~h!PՒ1e JkZh!( { Y9Gjs?I8ۯVJ)ۿ7WNx}k_7:?o0_Gޣn(O!S1̶VbBjzT"'?0q}T} zߥakKSC\Wj?S>?#g?KT4ġ|m#fS-,?%}ϡs=ϚFcc0a]LLA\1 I]\U`QZW -n7!J "aM'Ohl1XMpH'qНFN,ᇟy|gj<3̗SF%#<0ɢx:c,~?!X5{[VhƁ9 $ao"w~*3aGU;d9ĸFwf:OB0mK((G~}:di8 eԍI1,1I*YFһZ%L"4)Yj"ެ\E zA=S]YkM:GQw`16Ćc$8q/@*`0 M qr;ɱN!|CKMKy"Tb-q4'i6Œ,*1wM2D )Ķ "y26킣S/c@aQރ 㓅Vȁg~%INr&]ɢQk:z0w LHn b&$aiCNxEiiLr^ v4lU`Yz9M5~!/T RTla<ɼFá@𱤆k ?V}Lm]>3˗RH^{H~9=yH{@_|>,G)>잯>ڏOP8O=_-/4P˟97dV=6-+ Z^?z>~vw'Br;G]?Y+{L+U/z$ьd2  #E;yLWux|֯}g JPNSEa g'jr ??H}C(ϼ _Fl;ȀfAόp~aPI9Z@GOJA_f([}wgCCQ1㗿'>I<{|sGTr|?+ɣ;\YKQLAGMON?OcOY~Ϛm>??Gac9vǕ?t/oۛIXcd:]`'u+<|lCo?k?ejĭD2N~}!gݴej犔:$ ~c(ڭ{T?s§;^?| (۫JϤ.a>|OK/GÈXeA x|WA\~Ǻ.Yx :׈\}vHπJ0wZ9#ur9zΫ?[1c/@i_9 OGJ1?7տ^/_g)%?= X䴿^r˟)y̺Ɠ߫ڙ גp~J+INǸ95햻Yŋ.^(JU!X0c`Ærh`K~N2 NFVd45{{+?;$/iW I¡y$iZuoϗ}vJv"OX:ںCYweZ4~8[ޝ+Fߎ|XټMݹUӍ iұ .p/DR $0Lۘ5O?Te`G0;Va8b>AHG(dCtì,_V_<9E8/˯#ͬy{AZ%ܿ 83@oi,8#\㸮KæѰ.~X|ZsOkm1??sPy?e̟b_!xGr/7D {ow'u|A8Igel-9,wʴ<=d}P qK8FՈT2ޓ~{׳]—)reD#,OO=y3~D41t+w"[ꊣymyR97?Ar5>,~Sǟ]j yh Q\%k)CS#/OJkU3v{+s@~_\pх\<8R3y;#9N5;Wa1u_gI">!RBs~H_$~(ssП-G'/9׏[jr9c[g5 }Os`~` c9W^jk=A$OJ*ú%Xw_ǯ,9Ebuqn N&Q?BH{ iW]DzFy+qRHl~7:J?PiP/#ؐ3.{I1W=8} yvmB|wКhgyP,{|R§g̯+eycJV}EQPrGɰⴢ^mFT})Gb;+Oè$v;Ϩө>kۚz5\ˋyk=Z!BZP|H\C \]*IiH¤UZ F^]c>SK$g !h?94󚿓?Uov+ 鿙_I @'o?k^8J#MR]$0.Yw_N4y?{_?V>~uXjVэmZzYQ󠠫*㽁rLr? 2?#Mn{w|az??XiFϸ$4;xӿţo~؉Ômy] ?"ڃj:>Y\(ҸU2?F ɎۈOs23f";k~X~C~G_\{^Fv =˛$$XK ]Z=،PG,M.ǘOϐ:u]?!~ 5 z4}7O?{‘ݿ~q_ԭs/`?KS}cont=O aܼϲ\>(E OLe'' O6t\Oi?4}FU:z.21%|Ff??h)!T/7^\36c[/7YOJUFò9+ZUn=T zaTf٘bĎ,].]!ChX$P;&b̫z6pMh\+J7+OU4qՀhرtGVHZ Tکi//HLv|T@g嬽*ٓ8E!@5 "p .c̶LrC!ťll}H#%Iɀ=?CjH\K1]0 +|&;km$P;$ نFACIO}xMwS*MtԜxIuƢ,m$*r*\k*S,3 J,F'5$erof,ޛzm< ٳ%+%NW|bX/DK\7dZiBwP Σl 7k5XlrTʞ2j`T;%z(@ĔTM;wWW Wzv#lL7I;c႓kfI(kLnˑ͸X9.C 5yMJC $RG,DHe;u#  [ r(^7DPcjiU1)폩8AT#J>p>Pb#QhcU*"B*Jc\ W7=ڮF40%pLtиJs|Xr v_l*[dI%lL,9lj:PPHaiڴW5X(Δ_)p9E@öKt?;yJG׵ =EH[Kɠ5Ѻpjɏ=͘02}ď}jN<#*v_q-k͚:{~A7wRϿr6BԌc3/#/y'B^]ɦI};:ΛVDq\V12h7(DOvq.}+q3,#f>%ȌD 6`OjrHXF T`*pJL F F3pTm tR #i m`d]bsXŝC A ];n(v_,RUـ]z|HȔBD"$@dk!LPi0rqر Q`ǦoM(ЄG2$#阓\Q-%ZCŌ\TZf\׾) FMPwA閞6 Ʌe(b,%auI%:䭪)mK$ 24l.?r86\J7҅4C\7B8W\HIsQ& 4y?v!%ʮX"ehm"iQޚa B(-p?[zri l Q& ӶGVeksEqm:ՆCTcCd6[ZPh;-ݞ[fmƛ~DJ\)!?WNk6[׊jpS$$0.CwR؎ظAR,Hk!8FPk`zcĻ-mL qU2B)-!IY$1Kt݃ M YUJLrI~F*p1@h#_\R|7W#*^X=ҡNU%janDaBÏ LUEz(Uޘ=HBt WL ;V m6†U<0u|qn]+ZƘUp5CuBULPæ,<8 Xw2f_9 " :KqivW [Y02K3#FMY <3 "Pڟ Ld][Lxa,R m(Ȑ{ )AdR -KBՐPedS$$.y.rx7cb(!ʲjLU2(v v8)+YCuNc!Aݩ8oՂ* FJLjU8b-qA&4W#ª 1BǃBe▱_*`+o6oU1CuƑۇyM֥ Jxas!ɱ[CDI+X&9)#;W1FV*㘌Phq2 VW7̬Fb88-03M-WٱJb*p$%j6# /ԻSQVb6s8bV+Y<{ڎ%ȯXèFBCU`Q!Ca톦DP71)VPkk=I'|yf^Maam4'bw0hq22LUv8Uz3U،xU!k kw5$.TGUp^!dr;EzN\ټ011+SQL,Wbhp>>@!n"/T9!NM"qlZ;إ)1KB0*Â%`,RP.6PQ'BLR?P|_asXsi85`z/qT^WN\We;-*Nr]*o$aø5*9T}1[z4>F [ȭ _O_TIQZuiZ8z`gIRۓKs %]$1FS…oj™|fj k\^T%M2gvVq\$rY *UP!SW R!#`clVlO2H^u,\,c|U뀔\;ɲ⾰#LDZrs5l 0"ۊ0,$U&xcltWr +JCB}Cµ+mխ3ن;.ؠcI݃b+EA탒N M݆E YwTY힬{a;a.5Ѵ+&)%$cRȴEwflہ^c1e5@/cϠ'ȖNH}Za󅖍0~]2%ѐn:ȩ h3B:'Tb`{>8 N.?%dUWZս77C (^IUTI=b˖8be2@I|bfh 'El .[cYYOzt`YUDicoPgl<_DY >qBS 1jkuz{=,xNIʤ< _hBŨ@3Š/ gژUƖzK'Q# MnRo ̺>^h%EnBdtHPM6^$1h}1v." g:x;7 鯈;.z̶JpbjwWf{sx`ieС(KÐn]9z g(<<>qKu#ۤ2KkyHz}<.g[eH]+)ƻP槾+MeR^+EPU|yM(tk4IY/V0!  }9j`Q#! G/40<#dHnr9z;nr(v͠qPL4[dž)4_v( 3xB4g ډR;gA}_W]ՓhnS =7EZc<}alzHxR/pO:]sK)tlz+-j/7 է|sIT %i51WW((n4hd>Jג.KF Jgqgѿ1o=JȒGj HAsӴ^jBQ@3oAغhjLX{yJ nq$TL~r:|]LgcvQ@سI{9I.CrA78}8r1A/-g|%Ov suO?& 禿1?/|}P[H\;1ҍUwF#<>Bn~<ޏW#O9x⭫^ezN-uv|MMi<͞?6uq2XU|UϗŨ]q%D{oL;μ43uG͇Q4~ "HnK`rw2v2oB]CR :tJ2#Pb6c&R@?r{ޏ)c5f]aj Q$]{°K;㈫8-)p-^pAc6 'ql UkᴉaGsƻv9?O)C_ql$Y.4%uuWlV3{ FHxG8Dnzv=42zfXCX_-孵}dV܊< $m@KIǫ+q~}y玲5 1o%Ҁխ{t#h`a>,O8W5Vk`MTI}@*rD +}[2:(rz0u~#91SsrWf]6N;5HǬ¶]nV^miPs~CW=[+,BPh>#ngϽk{4翄&c{/{d *-hFs_ߛ,04tmOMԎn$oO9\ 8'C Aq:f1(u81hǛqz,Cp$R88!Oiy.ܶ$h7 2JQb1<ȈϑD|C#*7`^^kE«x/EE6ػ;4ذF1:[zj%d͓UbX|J>pYZ *N˿?O5\6"KhHGxy)ϙVyI叏̈=0%F9~NCJ XPSHNT w'.oP#*eh+Eic`jӖb{gyDd<1DT+'>m {R4b󏿑qMj:4/љu @ Q9 ȻjڏicB3d5,ԣ;7xa_KAEw_RGS_דyojJ;ZIzpbRZaÑg&#>)b }Q>)Wuԇ4R||Ku8HN*P*>jլgk9_i#pQ#:tY$TLwnCك.s%/x,gOEjZ9޵MJ}3ξwKfaf>[8BKzk{Sɤ*R?0=\"S#d.\9r4;);~a'-95:ev0bCPI3ޡ4/!0H0Su.S #?GoQo<մo!geCaJ;,7ߕ^SO56jj?!.ف.;libc828frho%ᗇ9ˋ#?#|4/Y;ɚ`xVi9?#>QK/l#  :SهjPΗ=˩Drb̠l(@w^Gux&3#cDמ'z\~$o[wYMf@?H5ʚ&5/TzziZbҽ6<?K}=Ԟ y%Uk_-jlmm5Zzր9_1_$+&g'ؑB)S=3'$c?Jx}['fo\Lo,&$(iP+J7Bߕw4TՓhlB!Zu"G MqF؎CK9u#eY%wӽъ"SO8NvU!jqn/H~T2fVSp:e}\QɌ/~cȇQڽ) 3ft1vbG>\p #xd! c7f;H/'C%#bjH { WBe+/og?Lc*gn}){s`Iz VPP);oaq !ήP/;nM9Dly?ivwR|Y[RivtM/6|,rWKKmwhJ0&bb$&x' &Drpkd0i\H;m,åiV$, JI8eYWߙaWB>*8A#3*O¹ΏkCdg⁆#D̎#dq2OdJW/z`|hjR '1HIڣ|'|M{L6 rWM #( x@9k0jS( o"])q ua핅ϧ ObwG_9?\]ZHvϯ^l:&.4M2k{=EGcZJls8 uYFRyQK}W?g]Ԯ]o K֔ <=W52Ht;?_%M+* *BTP3M 1ǐ<4 ȈWk&JfQ.0 ]A=\DDQ9Tq{:43__]^8і$̦`C^,W2=/afFČHMJ#x;~Ɇ2$+]T׭YH*HU'u*7~K`}{@oou8YV dTxd1r6|{O=^ϟ!DP<2c*tGz;m?diud&`nO-ǸY.藼m5%mP E| 珼-sy {ouqͼQ%_P>*;}äэaF2#1b>cgO.os{cj7a@$Fds؟鞷'w7.?zמm*ìRvcqOauŧsǗĥ;/GsD}FĦ׾W9ەj>,?%i.QtIU,p*vaS9Wϔ:jrz:^ga]vA-GebˈȞ2ɑÀjq">϶35.6}CH"3]`y#IPC XvL;s}CC^(\K7A>A(-ۨ4*3־\<64}'̷_W(DXTf#79=x\8L#;'x~2֞ҔZs^~^'|bG?meC_d8xkJo0}oH*>*֪|3CVsjpxxEYA]7@{;Guzi =UDğW_ލvO@QV.{+u}'HlH}kʆP~֌ݾx__/G?A^_~!}vXdoC+k^ԧq7y~p S`^h88 Qx{k>[>y$o[4Ɣ* JЙ"K]>ƒ-p\ o$'BA|pf=LGE"_Q OTN5 y #cOlGVB~#>9Ue2;۩o+̽ONmz)&݁W-Ca];,1KCL]d4VU9aVqW p]'\:' 2퇰1Z TCwf"ܕ;䭅 eӕm IVĄ{ "&N@\o)4 ABh9+愌5cUPڐErr3(5ʬ$W#WիUN@9n:yM)Psp-IrXTؕԟ^,C`w8[!N]n7 !QTb2I1B^Ogs>W[ b0+®LUXٱWf‡f0%u‚ݢ3J0Z.u,eeiQ"Kij[R>tϩܲ屋0>D㿖c{CD# EZ|6M N!~ՊI,[u8с$ ڼ[/X{G4Y <OvgO)e8@ ~Nϝߘvy̺Sԯn4)m3"}xV$+Jϥ?w<0=M{H??w'ape44nll2]K0ƴ#Ur@~͐aIYx8̀9ەι'ytؼk?RWxgYQ"EeXP;-?m 'uϾk{?&>ToIGJ9 ]jz/ƿ̫_/i>on!<%G11,jh*AZ2CJq(GڍtX<,qg!Q|kvfSDDH _$Zr7v+ +?|O1L&V\Xܽ%A5B38^ɩ?vU~Q]k GF/ZcVE7:b]ߙBGOߜ `¿wbvH4y9Jg? eY@gB_ׇqgڏ1K_?_'e^jEY6 !P}2PP 2d}E rFdD_;{_Ҕbd$l W<Vhd'~h`iҝ7ηǣk8K^J4*rY{JBFH[혰7FORǟAmsn;OXgc>nB߾_ZziDpqWkM.[I-SGCJVx`'>jysgA"ٱYKX~L|Z>RԘqgX;/ˤ1M@^Ϭ^^y{HK$v-"3C#j/o7][tu*һ++ Ag>ʁ#ph~=;[:opA؂q?{o!f૧wm$9_DHG#_^Ί×"i;Z? Gm ?^{hɏyiY'5-#r/0Hڵ"i wV&8hZs|^ Cw=C]`@H<թ$OT̉_O]6\Ԣu {hZXdKLdUc# F?fx8P0Üm Je"A5} Q7 Y%Y$fGU,1:\<#=QMuag{`*3IrvI܉DN|dMz#} $dH1&"~E(t7}Q (lE*=ۦ>MMEB( fqcP9Diм=OLд-7hV>FViȎQǎzf AUC5!R"v5Jv^eٮ%MxKFԓM^cc$=>3u\ )Cg=_?_?V<Q7(^J Tg['"II$J21 3|+Sswӎ#(G`w5ݹgbj"fIcd>\ݞo:zanӵqp^UM9nMj$y@$$azB|װP?TpW@HCw8x+4I 7W8_?58|4/,Q>f!Yx%OM "R$R^L3^xd$ٲOtANbшLQ8|L'oeO@QM0ݥť&HԿd0P[Zp?5?gO.<8Lg-ؓ{sw~hrjeev=%~Ѯ8FC2.Sp;5ʫ/6Ͷh{Zh+oWj2/!Sɩkayi>#*CQsz$y2#+7H?#i:4w` 0$ss2/M%7 2+dž:Pz 15(l?~ö@&O>i#Hřf$ԒzN}BDaRjN}GnXΓqAz8 k{աӧP,i B mϾS|8izI fRkV4` l~>YqauūU%c>/ңYKM xȥK/)y~Y/)*4/;[/7k:Cs ItJfv`)KݧK&Zŏe@ٕEQĔre ^^m,ļ B4Ͼt͟w<+YvUL@$R@Jkt}Njd`ۂ32P 0Hș Y%3ԭLlh2`D(hpT,qlz([,%˂W$9SL #jĥw(7ۉО$N'tpbɥӛG`-%=VqbW+~CEٓ1cGr]R8e-vy3N^^󿕼y'K QiKW>~iW vsgڜ.)66; }3&n vs7Vn Ib e`{EForc ÌMnWiW7cEn=(TǛqrr@Ãܷ2^~_WG!r@rSpm H]U~b~[X뾥j+{!;(n>v.ҟL >֛3i e@ED('r7Ͽ6^XlKxp]ce;eݑ즓edžșK|׫\Sa(1æsO+WVj3X^^XSةA΃Yǭǖ"q<ą=ia u b~k62XoIe^/-ޒGd'x g.11됔(7s>LW~}%??Ŭ;Iff@I$I=]`# +{:oP=_hylJ~aW`Iе+LADXD~1@MOBԓJOdt}.?_.Q&E{[64 mv {#mFo35/Ҟeե T+^1ƁQ{(zWfvḞj'̛'z\2$a~W+o.jWq$C ,ZT+Z k{cٝ/k,DP&&פZ>ˤ@ަ9_MڸKsaoD2OIBPn7͏gvV.0b@^ę}F}>U-Dw~\i 6;9fdB/i,GT)..#N/֭7<#9,VW+ȕXI `(ڔ:}N0bcNyQ|433 &@ qyVVc2p͹MG]^F;'?BW(c+eNˇ<1*Ks_2=U.)5W@} JTֺea53ISVZZYx"PF>(Fo?gAypÆy7┮)HLj"#3b<]:yܣhUsY~kNד-N3ix"̮Oc2A9{OP5R|R#^去$q@1CέfO$⦵5J87B4Ε=pJe z~:e:g4ߘɌK%p2=bUw:mvCpR* Z.'󖿚W-be( =ԟ3Ϩ\S$Ƶ JS=̭#{ ͟_Pj^kxxz9qukJmJOn88)_ )8r5z s;u}^Z7r"ӕ+@ϖJc2_uI5ꗨҊZ#02:=S]YAwq1.^U=4h?}tFG\ZIPU=v`Fu}r#AkLi.fEŜ1$El^h57@1(^nmu.flyZ26.C"V54ھlw?1IyS//EHҵ∁U{(ge`xx 9O6OS,KzW l11hy^F@XUG@d "s yQ h|)a _~קhm{Ȁ@p:^k~ڟ9ʄ)*HTEQjI ifn·C$'Y稗%ySveiM);aWmj Qg~KX Pn‚4^OnX@$8mOOr2.R6yLgۚq16eVpjҌTP ֽgiMo3Gem_?U?(>T,{ WYzԡXCFtgtBy,ux* nhӂ!*`vZ&'QN~]jzwȒF1KDQq=( \LKOM.8ʵԦaK2Tp)5+Zz|g]o|?./п:>w֣E)Ȣr^o~gcY{6CLL#>דkS3vEY@G$H2N7>N?heR`PZ9h&\xq/g!& ͫ3€u=YWW5*"€Pd5;=Q?,j7Bc{[{@Ycgjxc>yP(.c%~ C>%|ǪϨ2eGEEPTTvqh 1ሄGA^mLˊd(aB3֟Zq{hqn̲G*RWHr# '2lXLsnk9nCv"Hf*)C)yr?VKKgkhb Ji@āJ\et}><8Lq_YyCr۸3r)c5(?: )o_?YF))OQR޴ogݱq_q*Qhi;C.3u{av}Eޗǟ^55#:7XDѴzp0$a_FIQ Gحhd9rcRD~|l9XaSCqD_UPvƵo1h^].۩K )e1op9;fM֓MgnjFq H2F~}y;K6XJWl;uhK~e/6T^T_|7/?-,EZGd d#,}?UX$B $]}vL}e`OMH^ͥ0ft6GYCTmF~bjqk]yIb֡k{{{fW1(]##%g7_*Xl9UwmϢ|Ѫ. V@UMT(>P%m?ʷJս->nBxEHf?lځ/,j=\={Lx+b^ %R6+Fx m7{+mQGSu=F'h rS9Jn%NTP*r4f69kQMqH`|Y:zⅇHZz`8¸'ڇU*qdv?@ΜSSTj;dsU(y`VO] 0*ch銭W ثtFثC͊LPWbp+bʮ*m]b# 5=1W`n}2760(NAyVD|J0zį$*lkgWX&DžuFbc,`Q1 ۮ++JB-dL YfFn[RCR]64g>Yf; SAn(s,*\8\ӽMF,׶DA $iX-Eocܳ h,X͍". Q+G60Ȱ%ؚZ˨JkSNY[*O>"2zlUUUٱWf®ˮ*vVC]p+Sv]qWe8һYMGx'(#ڛD Vr4 tpFA#I|_hz}ګ C\Qa|h!1yXٻia)*i c mxc| PMjVZc Ik!mёFZư!K 7H{BE7h8nv4J敯Gpw?*hAcyj;`Z *2ƚ-cAnY*U:c*lP\68´Z{A ,]@@4d̕,$v8J*YF*C:ƼauǚJ8xm=W˫?'PvȑMBO\pޚs -X)1z\r,zzak_vc ]m;Vh C`6^ݩ 5u``{/arZj0#  I0\qZe H]Bһft M+fH܂csiHƠS+!Miw`N=\YqJS*dɴr;*ԭ Z gP$Pp&& *7!9MF,#SCE"3\UI.mE)z#|g S:Wk}x 6SYONCr3t`s]\PuqKZq.&\qWe1We]]j1WcI*Wf1EEzbY,]xH 1b㄄$W \ VH\5N$Sه5dfo1Xdz鑺l; ,-xT b\TJڤ)Z6!WJ-Mcn2MvT i i^ 1S$$$#h#ɚLL(DrlOL%WdnڴZUI GT2Mt‡b)^aDbJrDW&~wfE]wsY"]2GAPrbM4*[F!Er-f1,Z$W6(jZ#lv KX8 Ti,aEa g(ljs4[4hk\E- dFr502v \U`)S8)EquT W9$[HfΟQ,AO4kQ=6;OErLST0c]0ءX+*~c\*b X08 ۱0! {ŕ;-n(NLۉi) *2qVp 4e2hpI^W_TMU9Hٺ|`Y DiR1I.o-#Zſ)kjJ"㙖2 `kLJ)Y J3P/L4NcKj #1܊}; *챶,vn.ʥqE;*)Xbǁ.ƑL(vV(vl6B6vlUآF۱xJI`;La@{a:&4Fh` n*B:Ն*@a*|6\I#UY`I!cɂī,cy"#  H-&P9e_vOŪF660&H*aۦ$eÅ]7CiRTSҔ\ 2 TDS"IUZ,.)"dQUL*cU>L4ZB24^KB(xacjѻ?k}^.n(.@ 4u/b$C炎IWbZe\UiI ǫS \YX7\W5֝0DqJ4ab(vRfRQidE2 v voOn URV -;9™ ZȦe녋E]j`Er_E@V;dg͏wM(.fPAɉS\M_;|; 9kQ Yd&tŊsfZݗZUSC]!A׉Fې&Yo^Nժ=&;w4Ƚv^j22GkDߦ)v C]+0J>%+Qp*`,0*50%/NuR"FT6BWi*5忡!-bYXw qBj)v(;+vUqWeWe\ Ͷ*I]*H,m\+nV 'oSnM=z5xe3#! ,Ӱȥ i`r1chFI. p+BHW"v\𓓁a1iuuNgȶFSUMHKlQH0tmL%XĺK*Nc!8ZS)ˮ\Q8ǒ d--٦+wlPNr!&^*pٸb`C®P`WbepWeHcp``P).ͅ]N;0.]bc]W#[vK\݆%{i6 !S%+4g | (rV®52+2u`p32hTo2BYEr(C:6O%W{tGհ-KSZ/lig,uĪbi@2 SWc FJz1!&R I0'x85*b2qWs¹beNJj¹.D^_%#ŭ/K/\(m&)hz_ j&猭qpA*/Q†F0m9 Vy ]\D`"7eAҹq"J乪$Y쾼QPV}+ɓ]"ݓ}.tinHA I͊V(:Wcf>^糑sL>Q!Zj;0u#o1'o G#:dx$rSU4m"xKṋ\]o/ÐHW.QInT#XT `ȱ)dŗ,B^]fZg ƭ6H^]bMt%HE+OӉ2oImR7\ m%~ [OlLU˦(vbimCW vY8RHvnG ,-qSNbe0+kbJchvl6Ҙi®ͅͅtȫ#$8 Y+x8Y1Uy FJG|mb+2!7?RYoG.x)R/:q{[D$5=% x&O~$>[O>Qe4o5kKfC8!Ó |+' ڣt^Vcw AUy 9!"*ȁPy14H$vWOAgH.u=Jb,#if NԢx&E #VS* qIF6fb5tLZ {z{+zңSԭnTH.V BM*@[M~)[Cw]jY V AG-q@xGU7|Ąŝw, [Ymu%[!IASƲA](+].lIBP $H`/@}`F\q}#e1(ERªAX !O)MugH( CC~Ƹ) `צnU\V1P4!RI2$! 0dRp;!ȭ̲S$%-n 8rBe>}l㐎l@]ΐ/ꧦs[@̖AUm"=G׭DnzTЌ]'yCÐqM lFMl5q%&Ul+Z\x%eqPki1:<ևt& )RG|bž[f`Wlqt5"Y4Mz%y;W!c vOb0>E13Clm'`VLqPH銬4862lRe$d퀪yU*{BOA u}B#6AbC4[ՁޑFB'd#E;Rxc}k]f ˭)v';`F,]0ݗe 7.rZyԍ&kc<&Rp; KxFAaӋ0>GMd7ai̖.abw e]]a*]*, P0S*2Bi )FKXk1)d;xoc W&phM.W9 ag x+n͟DPZPm<+,Q֌x/I]FM:Dp1.Z2AVZ 0E5> D)J*|Kw9?a[y:2ăTԍ4WKlXijw+naf~튎{$W埔'/4 'ӵqtmR2-dydD2zgR If'> "K}Eqs˿&[a橛Z$}} M%̔Z9Ƹ1 nP%bYU׿/|I?嶣qM_&ՙm&/5<"au צTVR~|88]9-(u?W%&8y]}^h޹sA"H^&>^jG  >י/5K/ݮ[s_ԗ]xn +f8+'k>N<*iфrbyΝ O]?r %쎧{-fԄ- oLɵH:[Y!{`АO miW WR:,v oznsy"Y,nC$ZHR$4i5Q FHu~f3~^-^}u|ݯƉkY%xe-ya$}yZS$%oG^!&p}>o<徸5eơՓKCOݗĕq*_k̠MN`Sq>JJo˯7'vQvS7*ޠnèHePzS%Ty凕=^|E}YHlܟW9I("bH1|-uiZޙ*ao9sSV>cO#yHw.>_gZ |m:̆5Z ZCn_G'_)Z7n.tdIV$*Gy*aȪՃ- ٞ')QG }ME˭^e.MZ.>-B%, k! K/ kKfK{b@}\@?5<=yb-.[ -h[RDQuaO5̦deޜa3}/of̢+Yh 4 ޵<1co&[_ݯ:喣$WтHoQ7$QF&W_“F؊uxKߜX<勣q_%DbE*oсTYHb /C8 'ºs4=za5ו6bXN}a<W' &&w.S ad|SaE' qeFӱZo,֒[qPw|UL+NNfb k][ -c1WbdUمF*7+qd:sR\={tVHI :h!<_~IƠrZ#Ƒ‡_MT536p٪ eL.\yFC R)&^(Q3QM>i`]rJKpA!8 U؛1كv;*Wf늻qWfvU*1WeL U I(vl v)]]N*hnءRߴF!2_4N[Et,LۛrcxGS˿O367c)'zؙ1H?.|{o.i+0,&7w%yƪPETbDSᅇ"ӿ&?.??-#1xҍy'g<9a<s '5H]:TƪiQ[+#M) remèhQ%cEW7kW嵿oGmv# u 5~P(6"L']DoGrՌ`;yS\ROZM>g/ԵKY߄rJ5H!ǏO/~Z~p~t3̚ϭi6[~"2:T 7؜+[bԈɇIXtU@g׃0 @r\.B;iu`M kK@դurݭFbvwiV6@ -Cfx'e,@F^S,̀Y~fyͿ֞Wf.m˩,eRBPTl΃ 5-1d$btRpGp7ߖVLf,Q~H-"J,fd#*Tz22]Y^z(HcnJ)lywV/ ޵^]CY-IO )bJN[[_MtpRqBAW?56wmyϷVP֫ {ey 4%N_(D}DJ"o=}KPr* >gg%/!D~\1ā<%UP$' i0! $L!=[] 7QҼBOZ`DHmL$bV!(Aa&EzCㆭ3Y<>ļD=Yu*['?896F% F֍h1CqKQhXobJR³)V''#$[<̪~D`9,Nqbb7B((]u]!0+=(v<`K*})qWcʚWa햣Ɗ2$2COn%$DqPr6+Wwlj)4owUM!ϗ8(6@+xL09v*`quªVZR_hO\v0(eu \VLR),`We51Wf]v; (ueRo,VݗƒN(.‡eM;]8Xٰ6)Q{hd%$b{[X"JE*E Wc sb~+T5D/xmǝ(zeRU; 0 qVV* 7WSQXhiZcՈ.DXUPvY92+ӒCQQZG}N+QIg' "HM1V[*[(5xՍ)R$邒-"#U4B`L/AN8+3*iQ[ $:TOhzacKXTZ(UM{B{][ziJs*SjWxюek届f 2RR Gכ*뇖C9Pbg%KշKѩT֡XBvG28ڙg͘4|I$i Y;oJN{W%ŘF,Wƛ[.ҧe g"S9@6j$5qf CZх)_r{SWi$q7V~aՕy0 Pv!ppH_݀|i1u6ZG5,/Jt Eh$RJ(~~V,W1`Cl*߮,dH[B=d.L c)'v3[7\zK㐦(yi *^W]YtYjK8ʓ^W;VCHGMOoмk*`> 20ʱ!1W`{bc-3Zs"9_@QC.QU84/'մ-Ŋ^qC+h@' 1t ڼI2V R^FYxZ LT;#T66Œ0Dma!Mp*b@qJn0UvPo L@]k0`p B.a%0kz{i lMF ȪKw-MqW0 .qJf&`eW "j ;e'FMgp"cuqKSuB pqOm$1V'|HvˍW,"ʾE?Fo)@զ BpG;e#pF!_mLcCNVoƏ'*aSV{V7z7፮Ȉ3,څӁl:6M~рf҇ xBgm].~c/\ǸS)z-8&&i.`ȭ U؃E1q9=FFg,&TL^ٽ@)bxL4ޙs+N Zv:]v&Mp!beWcLU@We쪜Vݔ͆N] VF*1Cjm2(vjbcHŋ]50ٰ%ٱWeab]8RP]vlV݊,qKBƕIZP1MINGk\IQx!U&_[8DP# WbBN#(«gxׅ%k]]NVBEyvI-d`>,z刖xaWRLڬSsd:^c!%' f !,P$- %S\63k0]A8wmzF 45zߕ/;|lGXqǾlUu|rڷQWu$*wŪl21RGMMbڇZ0!cn!^xx pH. T":Rqk^y 9՜QԊaHG*Lу)S lv/@$nА  Kt'v8H^]m%톨钻iwdQcncC!+A6 ؚd*ڕm{ƛx&E E ,`Sj+, MAa-[R"k*`F8Jm(WMT!-@j6Ӯ=6N üѤ=Uo55^$1Pzസ1 ={=Q "טZcHf]Nl ek/1&n 1%]#ڧJ F/AY6]qCT$%Hj6AsFG*(EN _S+;]pRe\QMEֹ`)U ҙ2[3P$ F PQ6ڌ>q0,X{,s/шL d:gxT|ъ,\4YE~xS1>bDQTvU~2L2[ve8 /vXƓNӱզ*Wfcc*qbp.Zv>ٺWb[1h[+k:0hw'◌+M N4/v &j-}vTYg# ifc ^'Ƈ|RjLkJʖzjz,/dգ cڣZ*>y?<"in WE ONdCEkZ_3Cm~v?$?:|êhz~euuPBKVhCHXd$" LGl #9.y^oY#NԄ):+V^A\BEzE0?/?+$ЗH<ӬHm5,{{4ci7(Vߓo7}$HIb$E dou84ň/ͯο:vFI Qއ.aM=?3$RIGo^ߩO@H `evz7V >P0uy+.yEX=}DkыQSh!ޥEArQj`! s/̞d򾧫s{*B V]%Tz67Ri/ háa.F@hX-j@ij1R24jH!y h+Z`l#IK]I7hº2с:[cB7Kl䞔 bFAǗ!ƕvq6_ !U,jWsO MpjSC%́ F22IrHT97D#RTRh+Aӵ93 o5k^xR{M 0ܒݭK]?\Pj^Gjb@E}4Vm.R8h:bGpwS\5șPD#$yyI63YJu-V2]@MB帆N'*kj015ZW`m--YOec3)@BVtjJw; ,e7/-C3jJ@˰UUy1<uvIpE,xҤ vxgWl?+|yUiIo%#M$q/"#褑Ҭ]* *+!?9as@>Z6z1NL]ij"CaZ1HC zW|PVkU3:v82;+W.ksR1^Ď *z? 'Hwsdg*:ehw2QpRY8{?N_~c~eozP%'#A **;bUpi-xh3yBZ{0Bk!Qd9x鴊 w& T_L-8 u,#R!⢢A\Ge7CT"^uޣL-F9c}yo=\Yåٵo۳fqpB*Fc5$/(zLU$2~^WSOi1^ N-:Iǜ]u//fK.26V+[ TOQJlv9&c(F(v,:R4x!*3B)V7U4ʭk~\RkX>xQCOkv$)Zj@YQA+ji%6ȌMEj1KZt8v GœDW #jTAqU k}(9*h*:`z ZYJlצ^/-(\1cQ:Y4*e1ec9oBSo L3+1(^1zB1])Cq2aT(NS,Vj⮦nR]Lal4r+T⮥:c8Brv˥qJie.fَb*bi: dg/B;1Sԭ~ ,3Xkrޗ*]&Ӳ ]C1lQnWv8S1] q—eQ)]"U|TIILf$ؕSMˏ#,7(h/a`2I;-#CC2ȢVa!Zb~.QLkv-W1Fr"w*6>EL(wCLSMTVAN(|ut.~Jk~o6MKO#  /I>-)^]CSi_[0?Pͯ4[JاjҘ}qsmW>\5oW>\Ym*XԬ% eP⇣YL,:"O2lZG[o3WCyNI#d¤@)s.GZ¯G`eq|<۩B32h~4J+?M@81A5ر|]Q~yi?z˺ӭ48y[-iVM-P4/uqK2" JFhya*X^ 3RkB 0u j>jҦ-[Qdg%7LQY `۳3; 8T+"R9*b 2^/:֙gwi1vD[H8Ƥ $@3]]}/Z[rZs9Ke/ċ&O+kmsIl4=Ek쵍4uj#bRj1WWVѴ?*h8WZ{R*V1긩*?Ÿ@s7>L pKmGR>h;{:ڋ哦dGrl(*2~hn~JF:֏5&MgpֲNjiT#8G7䇘'"BO6⽺쯶k̒ڀR7e;|DUڟg翛h>2U-H!T*aUXkqߞu*-V/캭Bx"ud *V *qēƧ ?>hO?4>뺍ukrafgh\kB$(zƛQX0*i^l}wzh4 xk:J\Oi4d-4B Ar=G_C*X}#Mcr0#8:yCO-8]:`%g8M E?'yb0d s.=2 ]<K~Uu?%]%YIo4E,beuY NTڇC"CUI#$j*; |K0RoϤyoRn-nfծHt9WkCGaqjh0ܑS 4->Kߘ?78-MgYcIumdmoZ|$P,*sN\IƧ$CԿz7ZWKzXԆ[cOYwB;~)8]^3J 1)4 |Z/t]RM$tF)tD&_$`DImxhۊ>;^1,5ǯ1_Emc_P}:Ba$#p-QZTQ\5zt 5{a62?zs-?@AޔMlC\}in]tl 44uVS er"_R5n'~l̋z矑?IUrxW`^gkɓ~Y4h(}a¡hŅT/S-'E{54̓jh ܚS[]R:w/&/2y_ޥ̬]c7I"nW_MUA#{pm?5[I ?3Y?αCmycҶou5!A74~Kĭ];{H\9aRT-E?9o) ӄ3F(H\[Od*Ȩ*2ʟɿw˓=3gdwp<@pB5AW* l )gh75#ozT'Hw[ے[ףy&Rݚ#+;Mwhql$ꬍ!roS:{֕8- ZӼi>{ͫ7z%JE(ⱯZci},69lTPKĦe6FSX:NAּZ@1Sp%d% `&!v&﹭jrLlNRz>8cgV 'IHji& Y Q@=8P2VH:Zun0S; U(x}",wh9}=5̩| q֘P'v0C:jpߘ<k=yWUԅ~[ӠqemBj0 hfb( 1h-VS_׈Q~B&#qX״SZ ~ R%*Dm)UPbn AgGnoS2b,G<΃]WXmBHd\_p"aA[XFm'Džz'|o̟ˍ;ZϝeO6KLM;j(' rf 4bId^} ^gc>Ѭ, 6m-b QEHE Nkd--G鄆jZ*ּNˍJWO*0۱vڛrSpPEeE:/2?04/ȏ*"* ZANSO{? w[ nQNiuIő&|SOK緔5$yi> к Yc`ZLoq @gM{}yu:MeiX3A)@MZ"}d}٠Ek{7Cg$򝦰r1w-؟>D$޹t=->wOʯ6Ksk?ަmo:ymܙW$VKjwS3F^kWujS,젊HGJfV%G" :Y=O\l|˦Fl6:֗P=xc2PPO ~t?4{(w2]YFӤ9YbC,U&W;2hަՂqKʋ/5GS垗>Ff0A5K]g mߍ6hѦIJFP)1"={#˟]&iUIxo3b2VE*pJ#?u03D]7Λ[vWۙc1#e$o4Ϙ9s^@>,Cq?2A/;uow4W 8Dl#GmK KQ3:д3K,@ŏ(~-ܳMH U@]hAL#Fֿcͺ直 J >KwP,!T0b) WѡU H"mɃmr<>p D,k/˪gH]d8VUP2Ѫ'aEtKsۍj9$=Sѵ>yKԴ]:L?7L \C!QAtpm|8.hsoOZ-}}G^qE(2I[P\Aw+?ñh1E<K'-Ιjpռ\Asg]-۸xc%x pPƋC6[*mƕkM:Uo -3lgy1z'"SXDk4b26@kZ8Ua=Y~cj?svu[HH-NTF$ 2|Aȕz*S+KSRگYiJ^T7|\|T;l@q-RAtDRTQ<ۣ7vkn0]hw#9-˄d=~+DZ pDb+J+Ҹ2)ؤr#;%f"thѶW/ )ZavB]"s 2v ЬlQMEbHhqd)hzbf B;dUM ST`8a""iF0)SR)nc@cB/+[_w'4-NFxV'?/Oj(cnylX,\n-$O!{B~WZcK\UQmKv٫6mC5q6oT0"$0H#Sb&F1HL'b޽p$- 6Jۊⴚ[Di>X_%/S)tL6Qb 2N)D A>CFz+6tv=|HTgi*(ë/Fn2T(66Dž]yrv -}9c(B֚M.ici NGVT.iLLLXһ0URv :c >0 JR^2(4M<0j@8b)`z񥫍-+;/kN'M;,0ZӲ)v(`*N UiE-UL̶"spKOTPh)BCWs D:WzF?-<ń`Ȫ嶈Tvܓs #L1g>--5* H}2$ZQz 6S,dP :|+iua֠FѦԎ)ڍeͨw`|F!B~BE+TxJZbqh:Ŧ&"@*HӍ t TjKSwYVzdzpHLE,*d@jOߋiqVI0$~a1Glvf$P +&W~Ӷ%6 i7*MGz}I*NG\|(=(6 MyC:u>+8aꨰy!@Ǡ^ PԊEIC"9\銷=qU>4;cL( |,c6(@jC.E0xci^iljf#-_Bh|0W_[ )l̀$k< &z}ݰyR7ᶦ xH[0(W1L*15qCVU'J|B2S6M+ƃLR@|TT Ӂ#|,R2YyHqʼnNzg>|mp&.l#z^ݣO™ QUS>+܌OpD̀l'c dIՍqN@`Zx8rA}9CDJtkf6mC)V+HJbEEqHv Vd6Tذ\ULӦ.*LjJS(,EB=pZ76]ǾJ%iy2R)hA1C!%M$tܐd7.*|[;`CGs?n7zvYD^`jÔv?Gcw`SX8 T<;>g'@0;i_dEO:2H¥k(FrIC.jV?y2R^Å4=>t C,d0>h~X VIRAU`~Yfn)*c4<)qeGܿZ%LXFX<,xP 9?(jP+fSm]֕^!QSmFvq.툵W26[ lIԟ ]SpNbϞ6iw[Yn5Hn`Xi=GdrV-w . oԌ!nV,Ӥizyo ݭ )ʌ: CH7"C[5Ay+˾oִ-/Y<,vڕ2 Q%QI v>M@ƿNTT>ScZ=?O d0rcjBw8rX($'EuWcҠMlʟWamiW!U&x@mUaB=J6nn!,G:r4`j&wHuKOOwKcYSJb0jңōO7j~ghWڎkyhkJ̶#J( Oǂ: J<:kߕt/4ވκ=թOIH8M6$f$b0|qiinI $SR~&7L)N|-+zuޯVnh)P9<U To5kE|5殐n4kxY`&6|vإr$ȲFee5u1 b?̿*~]I0YO^ǧiw:nG˩?uHԊ,c[ztm _u/\GkZNKe<ʤ' i]~0Vg'8şgƿyoP1ROO$qWL WeLRY%# -ȐAû{!H|0dEPe\%ҖJ7$R~Qp{F| im^i}'œr5P|C^F*ҿ/Mq445Ɛ8R{RM3J?¸Woj9ݛ$ 11MG@k &A;6RS)w1Mh9㩅 5-Oq%8;mMWiߚ=oȐmF4TArh^SlȵRzҢbGU)4?Ώ+ipfnxRVy-ߒiߥ 6c,d\Y#IfJ R<)SqZŔJ)^fenmAƝl҆wME')0ݾ=LGopݳ5jj+O=ic3/@NX[r2 {Ьi>mq-9 YN@AC5&X5]bnA6&\R %20O*`U:W£+Tb | SCNL1FFu=2%>)^0XݙV1+M*݈ U2aiDɅjZ΋pvȖ%ڎ px)(bs7,CLM K @1G\Q5AFqR1 b!Q:Nޮ(xˊaK"!nC\ %ZjcTdbjl(,,C- B&^P)cp!ٱHvYWl.9=ҝwʋc-MFJYyq+6 h2L㓒اlU0XJ*w.y?.!HZo~g/⦰<#0$\)Oב[V#PTz Cdsi Di Ad*\>[#G'?2Vin䍐/2 AA_*&,X/3~4"\h:MBJc^ E708AMj卫ORN7ъ/*͊5WWc~XU;)`*7;VyWlUc}۰DR9qiO 7kqO_D;k/yҖv* kd~1BʀT(ѱU ;%i/?;8/?&<Mmn8R4]OSYUAhVBʲ*/". 2Wm;4/ďʯ/I;U/`5mB˨ij2"VzՋ3#5jB09)?o|M Ej,%WeF ⑅E,(`KVIR i xǓ?*-^lKދcp[(E RU(FK qMLYE+u2%գu\@mpK Hv.7܈R`"֭~|ysOKHm3A1TOKHe4An-O޴5 |DY65v遐6 Eo-ifzn P;,[H,ۛIm1s}g=㿕._ր'䇮 [.dXv M7peO~LFȿ`Լ\j^aM[IwAa v$O*N,<S"#f8?"1SF}ativY/b9 7*uȡOIOfv':3eg t+ϿOǥd`?Š|~]N//?059ӹ7sZ͐u`])}5ӡ,zEY zQcI/:?5I_,^ 7Uǖ%rt%P ,N :`zZn%ST=+Soor_>aK&yGCJ24pꗦt%ƂhiOUvp+zp8;MLq[LӼLm6vvi?unʬbMfqī = ߦ*>T|y-YB4JKh!F N!JҘN(%_,?/>sIҤ6å$ Uu qn<9Z8K??9m?1O:QAi(114ylXaWn\F>,P?%<9U4\<V;yk85$$2ƀ uibu̯*ϟh~CM}橦[ݺw7+qB]y~qŹ6ٙhqI,s7ZƏMY|k^\\ӦⵎGxJBndiC(+ބoe:旚:qjͬjw9GӦ@Q9`Ѧws1UajPyR-9{5"Ëzs\ZƄTaQQ Hh +N#I&@~~@Yˏ43Z[=ā xWwu4 /Xn"݁*CrVQH^Kyg3_ȯ0韘)Y]}0<:J뚂ϫ[v/*ļ^p}Yh0j73i"ڴ!]@ T90D?_ZOe=k_h"ҧF&.$QP4V1ˊ95Bx䯝yrO|y-:Sԣ~бD @N2mnswsemdex}@BۯӋno̟;~V/ëhⴵhmcy.h@Q;bS=~}O0j^˾bgIeFdUh7S>@O$LZȲPq#*6G"BT ;=CN$Hn~&,kpfSy &W:n DkBjNUi1]b2E1|f báM`` ӧt->lLvb^ x@}82TNUsSJJKO1uRObFUэ!'W/y W2 R\~\JmZOYyu-I+晙sBI1w]Q/se.|'`Hy[47JX֭0y#Ff\!iqpˌfb/C C_d6]jZ&,`O,O,?BV.(# DGtq!&_/7:hZ_;*>EowLEپ.k?^ZΟk=BVIB- x$w ".$^J_f :lq8SO<]CekIVV]Zjcj1%P)+Pu;#4Ƞx䮫8Q ̿׺֡"0vakL<5['F05VB7ja-Ŭ1ԣu/?o-^.=)R -!VCHPhA ZZ#FhCLj^Lι8M'^G׵$y_.h6#P0\_Z]'(TPͿJJpgc 5aB}Ha近:g?!5SIEpSC'+fFXPV2e pUW!TJjO|~i|kGM'0[[{9lD77CGa)+3UJ|,k[O/kv-ֵM.X'IK~JdjfXoVR8XA:3Z~|^hmgʾLט-[g+rYص3q$0x`7`nt_UǨh0g'~diQъf^[&z4ߗqjMk(uśAbPV =+5ȏ?ySVisc}oxѥH!`|nBbĿ<%:9#?ɿwN^Qm͜SԒ'/1|_F&jkg}t9?-5Ci0k[?. F^*[nT҃MSI{ϿvRiW.;MafK3qq0~!VUb›V)`/Q(4?7>A_j}fA#,RD揗.~Zb.u{sDʌ2A87Qʪc@؎2>W|8{#A8Ɲig4U#FbÍT)&8zJOH-!KɇZok7WV\ yɑM!g/fM}pO"P':]˦Iٹwn WTU#p_צkHA ƻ.$U\*zCVBJdPZ<)vwM t[r]+yQVm&}}s%-RG">257opZ^dYK*xz b1upr2BewVU8I!Sq҇.=&L(!UdK*8yGyJ]Ң9-~896{{]e /u'aS%í&ғoddՎq;P 5 S9kI6GHسжW%3-}Zԭݪ}1gYqU'qLu1Bs@,dZ1T4HeuQJ&-4{dw"6s( q9hbFrkǔrkRr** ({b Hh]R$v, pZ)NÊOIA{\ UجP9+#ribJ]‚iR@ ҕOZ016X]#c3Q~y$vR71Kn¤}'Gq51ٵ5f--OZkzGLxߤQCOF%4i5 ;}Rړ!4i'(‹TF"Ĉ4m$Rk1 [G X%0:)m9a8)m80[2A+NN=+OxcKi]vVs-u=16Ɣ#*1oj? vSXw5 Zw!d_c-œ~$lGƙ۲&2P7lRNFHǮU3$Eo4??`6ƬI'%HWH^8w,L9ڹP{aŦTO\R {(2_q^HgM?d#狴a%`{퀕SIO #(zoҸ"xb|(KKV1rI|w) Zy!WE 5&i-~E?+dIZoP*q[jIuX4v,YBQ1RI?k)w,6LQ!'jҊDAō2Lm+/6vVثҸف%]E14EpkM,0p| ++5r*LQ*є&qCS[r$PA|"oK<&&kAU@>X&'fI42i-&OG>݃v8A1I5ޚ PCtmf4R[?  d\ $ cSTex4 ÐիdZ1KUˍr$ZrFuJyei 6\ ,\emt0tb#-'oZ+ Tl ~.zR+8]o #cbRIO[qr$ RsPp3CI*8j9:{╝6Fo]*bӱ׶ QeC8a"*mԅrzb \M1V9)iZLȪbDE2ag0wȵ1io]8ĕ8,:hH9Wj{b1AWቚaB2a[_Ĝ~9AtƒSu늩ҝ2*|1{䐨n^e|SiQ*qBl4YaF^ibHN8 MsI]km=W%B'5>ZaI[|Ljl[#|؟u(LFTTB:Ji+L y2Ɛ*dPOCSL7 i̦?F\!MOUYFr{TtO\iS63xU. *R?vQL)Ku^JNWQɝ-nd2߈VE;;\\PzjkG}ڞöI!H(ıS`iĮu-qp5y; "i_ݎ8 0g(,P$ e늪,Mk\Up!Pԧk'\jNN;Ͱ`{ऴnP׉#(鱷تaYOFb0s `<2[0]. A,znxFIr9}?߈\8I:4M֕ 5 !IAYZ%)z Vl`W7U\ {(`B?zTIكЭQ3RC2FAK9;mvN kɺ(k02y,Z]##'4Mt!mJlݕzl KRGnin20>"ݢDA5R>%.!Yb(a©,Oš#qbʮ*pM"+bUn%W٨A* bb B6Xp+Tz`K  Z"so7."a-wjbGlP-:dUek(Vo\l2bdIr㫊zf-1[|Uk ,\ C:S@-\ZmA& VeiB$f+튐8D&$]%+MXQ}v0߱Ͳ3fntqwRWâg)*jc˷,586~.(@=kz TJ:dPA9r2֢):*q8vqdE.|qA+*F7#uX"`Xb-ᕕW7ڸ 0mFT85GFZ U+pB1P£M>'8a |ˣ ZՂ:n%#!ɇ724,„bflB$ eL(VV wkK1jڒNn@ᴦ]Vd0Xj $!)*IƻW|BzT>I*)cּG\B٠T; ւ H| BdԌm^: ##VcAb3bB`a|0qukLq'aq;}Z_\ᵎ N{;D/#ǿfD^$ gĔ=ƳkkdJ[}YZ26<F}'|8_ ,tۍI*;4Q8ԭ̓`7c9kfL=y=>Ku5]޷hl*RGi,.k-Pf,tɁ(وvaXhC=}Ž:`Az܉#ĊS2|l<+Gb ~퉙o !1ⱳwpnO @ߠ>" (j؁`v$ dC*Yo^}&+Zr8ja Ѣ =?~XҦ ;b}J֞?N$0 V_( R*[ jU0RMPp5)0RTȶd|/"#~]|P 1^:C4}\0gs%~@ Jo7k)?.?_O|ڋ{sorb^5nF*hb;1er7i?W!Gz!K=ԖZݗ晣kVךZq".yuTaEеToǍZڧ-84>{X Dۆ H@C?NR> _Sծa<{p#Xտ`{=6>'}Wi̞(+6-@~8o9W0O}@֚C[ mZ[~B]VJCSYG70Fo`:ڝbIdVyǐk)"}1b涚u&OlUO>w$Q6<-CB (ri\bMYLJo<͡yTgu=M$.bI"ļ啕o\򎖺潯ic4*׷ږҺH ]K$jndQ1NaY*/*_U󖑥ch/aԭȱҬ)X"(XZIt`E{tېZc?'E|+ wO,gO=U3FNjªaQQ1e8WڣbM_:[gNUK}15B7`p.ƀ1vDD>wwy_kWg^iFAbO .ol l?Mfy_t_\mt:yy{qJHyeeU7=vc 2+chb_^Jۊɾl`$=E'*<7Wm|9(ɱ)+&yGz?|gi膱z\FHKTi2JBꁘq;urA(\ _ϛG4?ڻo6-R[зd,X(T|A~")sV"Ũ?09J-O|㏐}Km.E[ɨZ2;Iu$F˷p'&~iy?J<+Xӭ⹼ӵ {h%5IavE*A"C(  WFqWA˝mq5UR9 uQՖw8{ T-y#Tr~ɮ63@( bFsɕ+1 4fܟs!1>ff.jo+'..n -Z$ʊIQ2Aow ⒫Wo|m\>R懭[r-N`ՂG!,-Wk!-TR Kj^gd=:}`-ܧ HZU0E\}qT&Pe=54t/>ivߖ=[Mycqq4`D̤"c)M%\Upn21TTѭ4<ه\p> m嚍Ə-Zz#b9Wѓ!"4:"R^>8i9+ЯQbcIF&Z4oa|AkS͍Cch;e֘Z,NtzTwS C* G啑LЮ>N\ `څQ+&iRөlKօb'?~2VAH$]L@j`AcLY)'ӒwI0[ kԠCH݂J&Fn!O@(02ZwJn>RaQC`؜6E()(kZرRڔ=Uź ggyG1IփB{cH`wPTbu 8W,[ MNL@f*qbN[b1Ȫ2)p p]*%i\UbBrlͷaUn'U]%r~\#ͣ=ec\4S5o3Em?HEw ӣE`퍫]Ñ3sN[z`In,_JB}~x6SPqRx䋋`Ê"" K;RUAɅ0i HFE ]nVAQK4٭G"О5鄅uͧ{wI~hm\mֺjtvk2`3¼eI鰌R~,Jz(PjқcĚUn"R^?6Q72kKy'aQC?KV(y[TѾcV-/,C]qXe[!C}dFoS??n< u%7wO.n|2;6]g{HHrH |I#!-I>"K~GϜ4!֝*;Z +vk2QT뇒.q 6vuSB/Mwk}BUM]82O0CԟmjO : z P} J/ΏkiM2F?4mm ƛ@>^ /,9x#j_ ߜz{Nikgh ̈ D#n%jpYH#HegW@wĊ[{W_u+[)4Зnd2v$\QBl-4{IgIm^ܞ w/7&o||eK-j[ׯn/P$#(4# u\_Z.؃(hErGt=s_6}c͞s/BW_J=N$ao;\ ^J0mG/~S̱o~`k'OX=W%Q·lŦ%¬QZ]2"/oc^f&qǠgMa#Ȣ7a}!~.\3cGt3y_MU:ѷcN(B׍:OZ⽰1֧2W~jmRQܭ,43cd|Kc{ Ya;w^{4Ο:_|xY]L4Wҵ붲/x#Q$L3?% ]8a![pK[qϚn<#ZYjj&w2  b£ d~~b?%l+b[sDo@Jڕ6Qh}ώ h=s3ȟL/c{-Z"=i!<*Ybj7l]FVgcc!ؿ }ϭ~dSA_9|Q5JEcqN8YB*1bw%5OK-ɡjUWJ(/B1Jr.8!Ȝ Kogt D4 4(oEcqgFi$@dHQHZR ˦E}W7jߕV>FԴ0,73uiaIr]9Tb.T @*>2*apiCWcÏ*Lj‡e]+JV޴-cdNm%wԆAFeu=+S 1lAR˟>Ym4i. Akj%^ՒWy3Y$,O\@K_oqg˰4>5+S-0!_'}~WXyQ{aN̷1+rfZh/v-F;M "`V$j&'qʿX򎫦,Ej^@EZ?XHJ) ZcF*mUIxߔt!^` $ m'ݤxjI' Ӄ_%yp#ޭMoMsj3^]5}N1,1ywjV$@:5GDQ"vNAߔ?gKFi Dӹ=ܲb[`$V$5u8 #)=9[>xУ7+$]ZJԫC<,-h9-x%4ЭHb-g%N\cTo!8O4W-)O;;QW|:X>!'5JCۿ/' ?vĶl c[[/u%TgKBH6*p(԰½X) ':mg[+Yiz֙kqː;9hv5ee=)&KM&Uv`; M=p`[iK:Y\\NŦi݉c=6imZ 5!\4XUNηowdZ)ch>jud(-xΣ.2M8s.F^)iE|q KA/@菍ڜ\iy*2%i#Ι=_֚i߯;z֦bZꁏsm I ɩR~URd.8yo1%kͤ7pO.rY2ùܨP DTiRw?<-S+N2h^PƛIws|,Js܀OE* ygp/pp-w<68KQf;Wf۝SQ/K$mFl"1I v§rH=k퍯 aw8]2o.2jrkIi}Q?uOhMD5_JTmHӦ7I"ُg3|<ͥ}wF[_CFuxy 'T~\kb35:d3WpwrXO6yNĖ7W62]E*\}^DQT(,9yqPQN4$O]yV<-iQ#' IzIs_,[|`J `E1˯_o/$zf^]֦mBSNMVv*ĜBÚѷS ״1>Y{)̚Rj:X.4+*̥AV j k϶g0k66m'>&$%?iP1N8P SlUq?, ?ӸwRw[Jq$r#P^+E7+P)ߖ󂟓]sj:]FIwii#KV|1cr|MJdiۼ3*~~<ЖQןYqpQ,0GZdYEJr5L K>V>3_յO5OmsO̶nH$R5@kpqVhTIM*QG]8zn0|;c-\Q 7|*nVqoz~J2$0Mw5N wKĀ|H }o]Fd Jzb0 C{ :bM]FMdZ꘴Oe(YMF,a I9 qMUTI4)]*ƕk&,!(wZt;n!\ v#I*7Ct8# #KYl-C<Kig7,,dK"i0i\ɵ"Tdb;!#NT ǦVRft9qdhIt5ФP)?}3k?zbH;P;KZ .j#/䗢N1:A/zՍ[$~!l= Uc ``Y5Nd+]\R*v~J+hY"f_Q֭E m"vnJ`Hէ0Zyr:󢰩 rmݍ# 'tj3J;mƭ8AjS>bŧVTPRzVVvP@1X5]j֖…I`j 'mg8 ZHWF#9[c7UC)8\US%WL/W[u>8bmѿH[b-T<2OYTk(yoV(RsOa9'g#0p䇧Ř*rF*\'CĻpggO(#cpi BlLװ lv_JCRD(RP:!6i i^? clcزp"UnfEkv*hTwH'Ҕ=!(!\ ?m<~c 3 B2cbH~r)Xou1pǡ؈dQ|+- 4.E~ݬUe 6u PLUDv<i] ?Ib iVYOԦȐ/!X¸XdGl =q i&8 „1f^ƅ[zcjî#aWo-/КcZ`ՔId)]>/".I T~G {C ԝa6[ ]P $olt7+0ۨ<2m]hWq$wVVX$U;T-㩊aLU[D:"Y-qh޿< O!IP#4Bd*{ D=̇u5K`ٛUC^@w. $z %zbżA7`ipbL Ȯ*U:כ7o ynU nvfC^"eNsnȏyDo9{7.Iɫ5}Ktϥ/hB+;/܍͝<j| 3IcS ?O͞㥈ʥ?qn)=h*G|y>l4=*NZR+X$ TMIsǵzܺq圧./qa!Q!Jaa7vlUٱWf]vlUٱWf]vlU1#<00Mp‚!]GF4gK^j(!ʋvv-W})< 'ƛoט_[P5ev Ӳ8)~L Yr|nP_58o㴿Q**[ӵ?-_OjS@e#k熦"x%Q"@C䄱 R e>,1B&lrC܀!i' -A;{McZ dOM#G*QA튤Esg(eRFi]>$?Ytzr놶Zwi)k>UDeqke#\cZIJ`Rw;̦_[Ƒc%>S=ԳJپft+hBUQbFs5A0 bXy͙jaEl)i")bz7›e"Po/[3Ѽ=\+փo#W!%܁ Rt %U%$w)T/șmжa;iE0%0+x^FT wLs=eR/OCu;G{O+r#S?d~8F >XHmd] U[tF|aE/ullg!R6v5' eMXl /$I9t򑋑)NE?ݪ!/`XošeZ*$.z4krk7smR`JomHST󐎻WbkU 8ߓv}B mF#Ŗa_ׂ­+Zbѹ$QM:v1E;ޛ`ӡ#kӦƸZXccaZny:S_Yk_j s)I*V7whg~m󯛿/4B_VMN -4oY8=QB4~MN?>6Z"|mCjo.me;)5Ȧ( Q]Ii#jK)*<l9_ȽS4mZK6ЯEr/%B?Ww46ei?'K祾տCūǢ3~tp18nϬz_6~+k&D/ߖPz=*㾵O݂]C~i ơ(C?zПmP; "Kh%?$0uBu=Z{f̝ byX#C^lbh:Br9>6%w??~ImWS^ϧޥy:GqnDTЎ @rjW¸YwwG(m!\^twKӮ,FAIyTzHkUG"@V%[h!o|~VZߘ|[Y\2F?TPKh-%K*tR7s88#7!0mֽHgp6@i z71 LD$lEF@G.+FFrv ur/E I&IߑȆ@Y#q^mF@J<ԍ= ehʁ ;lE?tv-!B{y 5弄pkS”mPy )J \ WxSieCx7jz1?F _ [m).&FєVjJĺh!@"i+ 4nv> G3զ]pӨMVsg0WJ17&({`!/B*wW2(A9EW,ƕ8X8Ҧ0K $㢑j*}gU  .hF<]ia1+? =|~xR${S꓀doJaŻxLIfNՈT}8`I5TqqU//*僊pP90R8`޹3,@Q# u;Q .$ |i ƥ>~5.A7Ae}ȑW~!x7&֙`@)v,GA]zyL漼q6FI#ʪ ?rFxig"̤hl1I3O,Vo~dIhQd5cDdm>| fWD(r9d76'=g87QO>i=(l ^Aok਀>C<>y$g9He"I?* 9e3vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg'w=Fê:Gwo`9]9?o;|X&G|N?qu=X=Gr p+si%/GWkͪK_XGϦk<LOӿw来Y4{@"(iC ,t(FL54QTbʒ 8ě>R)n2w- @9hG-R(*8"JXW6#zcq-;aR=WJ׉ʣB,3=Nci^y/N8va&/_E%fGܜk ,q#O}d'`-?ԅG-ZՎX#$*;^CAN ƻr-~+:UMAᙱ"G,tRjnNOxrNHʖTV+搐 *20ab  Z$(4c+I*[o?z PjPdwTA_C~~[yzV(ڍ 7n yfHtCP8$펻ld`GN4O4u0KFB\W!~e&"SzB4-;~?i:`(σnCA[[ WW0<= ')=י9T*/Ond\ <,?vO6éN o֔R8Bo J!8IG(|qsi/GRP&Qh6SN̾SEYoI5i?MyW*n?/ygM~1* B>:jQH)XӒ1P ツ/RCHvƭYLU\sypb@n284NϥOM>짓s7O!: rU򷼉Sq[O|CKլuXo-e=,N<] SB4=E1颕6 қo燛">'*?I0 Ɵo^k]GWx3_X |I9~M~hKijWkqGBJK 3V /߫-/OJuSL[-Eө_Ռj%k[k李[b#=^E9m;*KfoyJZ/oneb "QWU*{,Cs{n|}FV&ć:G/?6/+^y^[41^"戥VjHA/P"K|dzw]3r6~[ZR8>:ZT"7~sqM|{u}Z VxIx}$T4̔fkI+hodťߞ|o^ځp ̏I 9]xsrIV[IהnTV咉T~oO+~ri^X|-ծw叮#Y 0 rVphjVު0HdtycR\+lFr6CbvzڐЊpVlmmí&yi=hTR&'ԡ&L;M7ǜdĖ}OSדq^$}O7>uHƟp?M5MY, Z@kHzx9y?ѭ+ q${x ,BZ݅ﮉ,K'½1"ƃ"WxFvKn,.5 OaIk,P<N(*pS- $xW@ˏ3ڄ*(P|3 )%ѐy>#aO ׋dHTmZP9#P0 x 1ڽDI}Xd;G0ֆ@aPku_o|TaGqx2̨Xn]0rH6S 2IŊ^S[ZZĜV B:eqT0땐 H9LG#@"2N҅& 0.jwR:溥Jˁ2CA"0,T;a@T5)oi4/~8䀋{XHu4pdX4d`Djվd.iP}9I"}KJ0 9me KJWĕiN=2E(d~ad 4=G#xiy%bDd(+m;G8r;aɶIbϘnⷒQRxaS9"hG*|bgnfFZ_.OORS̏ՃF ʦ6HIL=Gr659W 8CVzƑG.4[4@*SLP/<~A[ej+:^~"Hݲ/%W,i«-XMQg6:alOL//o.Lz>?x ddd; '>qg_ˤe^$f~f^;{ϗo4Rأ$+H@3|1^s"ŷH|acao/3˰^WΚ~g]m :AS"ڣ ͛}x)1|7IPw\^yZyT<$/7f!{[ndh֠߀l<#ǟM|cj"c1aR~.%άg& }̿?ŭ\yUz_+}Qʨ޼l>[gJI\PGPGƷG'[~Wy˟?>{Դgz&k\Mk)*C( PL<+\}Q?D`w>cH^mn}Iy1 * 0ުl!_c|ۧ~t{Ļ3C?\LԷy#5GShwb#ԍ!* 'CO!YC:a~w^w K󇚯5;nFDR_VáZਥvI|HA/?o濟ux1'?pGY$>8ZLRUfW#TWa0!ãyO\Mͼ^n6k;ͭn?x@n̠)έ zd!RƦ֋ots|]_O['ߔ?43sk7urPkm$I}킳3:T9/;ɧ%r{q`GZuM}oRoa.! gkdceR#cNε6K1%D=ME|)!?u-$j'U\ qXC{;Bڊ]0'^u^*m (lji*}=8+,3i_.y_.K/KaKʎ $$M__bByr?r|ndui}x"(#=XRolЍ\Vz7Y1O}s?m`)thiI/O!V֘AHV]~!2' 徕chc&QrV %Z b趺tb{ZDi#5IN^3ʏ )ԵyuPGwIѢґL+}0Vƕ700SS޹-E_V [HDցAOɅ֡mƱǢI*FLElqs1Hp=Tde뇛ԓxD?T[i;oFRr}Apz|6Ȕ(,Xoƞ:\)gXX-f};+m= hV'XE+_% D_a# Y:Y Cnb.S,ZX}?dըbdv%e,AbYh5HeJQ#$R-I8 ŖFKi54F=X8$sSd &' FHT`8-Әe1SǦj^^]Md8t_=~y `$ݜWJ5Z {E׋x8[air$3k n%FϚSw A V`Rc70= ⌵ *ɪq:Ҙ)QJԜJXն8"Yw&񭶧%´_~"}9{8#l8t_S ד͵.FI~WoD=U-QjQoǸ)){{Ŗz _.d۰ʽ?:Pjf'hLzW F6vV `GWă B^26>sq dT>qy19}E-2Ȗ\Wns;7ߟZږ~:rH븎1yXtZG {ON.rdюfv\G9~: yu~Vh,VSMBie~AR}ڙ{O)͚\R? ;wִhi!@~7vN3T;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊<9E8~yXK- t cd$۪|9^{e&1倝Q#(1?//^Tԯ4}^K+9Z)xn؂$M&2% "'ˌ&2G0]  v̖rMi ( C+K'}}(j2 ڤफﮎ~,6ß}oִRu.4-Z0t"lS$LLӧ%؆:݂L^_4ҹ3D0{ƕæ–-GN'#77FS@ve+dcF=eTdNU^rE];Lcڎ=8Pҽ{-:GZzz0@&Aؑlnowss9(VӗZC ڷd-ٛ ,z&tHFe|Jiwl=99+D ! rҿ/#0(^S' F]nOц֋+%+EOYQN ᔉC\%HcZ ӦL1Lt_̕^[AGݖL}V4? T„)2䐧ufؽ2\I fv"; -1CS늮o|c/"DG' ZG+2,<D{ŁM&j+ cz$tP<I <׹FNK]@EIJUs^ZU*  C7WMsHZ^id,&edbKo~ }8=D~GQ) 7#N#"[O(XL+A3Zte={jya"Fhx1lJ~_g_a9 ,Q>/Po?0$jGB6{IfI+%KKT}NZV5=Ϲm4ȸ- ԥO#*xMd=:Չbq*~aFP¢ -Jtin=tkUt/˾]ɬ yfM˓??l+JK39׭BjT:cfCehdJ䝷6'Ύ :|*,cV񵷺nY^IMI kZƢ=5u?Segv|4 v8b'#aoh'l=*BQK.xm _?եo{̣iVxIUlcY*3 s) kȞ8RxeD$\/qNf y)ơ4uWLWSG|Uh|BHAɂ Ë!0+ 10ڀ[^kIAWkHl,ӠGp81U~8݃7Ȑݒ A#| u)Y+ŮLKAқ+T1 QJ4UNvCM)V\[v)P0;=Ivmݍ<]uew/.:@)v\Jnv? cvaWc-ZwsA@zYF@~Wub$HaCPʠһj㊵M4UzM!`n@+!RH#b3~O~Hj>aMʰC[ҵKx ݌Ej~ʱ~L'$)~5x!#o"yF,| k+4՝$Aǹ>:.9e)H;OŖ9% %L cb➍SYLAvjZ>% maB2EZ?Odn|kua-c3Io[#h4|1S-PA]Aݝà )7yoBEHPU77ȝ eieJ=0#t燌Ӳ^K:Y9S#Ĝ4i40EY݉= bEAqެHTڻm^9ͫ8fA= f=WJa"'vcfO ~~vQ''g9D\a-~(WQaC V9@;)휸u=Mf#x|kOoαnF|r/ա岒E)؃y?ܖxPbOZ 3>@uPV7`0or!iMT|h"4ڴvh ܞenm[ۗݚBAB2 8wcF-߰šjcQ7/¶P;PVjDGDia K'`;ׅWS˙\ԷOo&ZGc APS8j߮EdE!Gz}d,aZ]w5]F6Q;Ek[j[wo1+[3#`zԜYR>B}.H12`J[^-N ;⟲kOJc 8H#(:VHA܁ E2JcqD *1)9wh \"yv(*逮3FPwɍ5ӮRQ!Ii ,bC7KkZ+ʝqWcRK ]9ڌdPYv' B70Ә~!T*;aUTseR^ʥ6WT*ALPaC;kދ!r@NWc!WE y68ʛtϧwx~_0ϛ.Od|6ޑ8:)e LNOMJqZT+㊴9[1LT=JKņ@fG3誠 oh1K6SQ@<B"46qyZ;{>~RV_4&]ܕ9e@goNsdrzB==K tpњh~ԏ?:ns:͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbϚ? [91il㮯osmDhtosߵ>H ywK߷exƀ}Cw>s㯧ʵKҡ )N|T)@_-@8)|NHݿs뫿QAɴz(|/$vȡW0J*QTZ^=+2Q j7$R96!c MCnRK5+wIgl@!ZxFqcZOsq FHdjsA; i/#WlV\Mx`u4;5 Dcr+av\'^ZGjHu bWe%X{ t|w8Z;5Ǐ6GW"Z`s%MšLHIP0޿1oGf T}# rC,D$Fv~Z,^>Ux068O>c7Fsau}RXTwH_d^Gh+3Keh]%Kz9ʯ- f4B)C؊n?֍̏2K|:WLd T+J j{ʒFH*7e}?Dq|m줜*<αH )OX)n'S3k:Mm9J[+Pط#" IRz2A-z90/O*K8iGok-V򦵮[:i.B1$*H.+k#Zb"؟e)/8?4?#y 4~i]}&+$r8ΥU(Q Av7[fe;}0DRuE'GuG7J&[K̗5C&` Y-AK +LG5c`'"4JkЩ`~/yo iZޯ̄ڥ=i%B+Nex k5R~#JpϫͿ;Y~I:uǗ$iq"LW E0V>Ei-Äu GȂ?̝n?Vd7.i=Zi%(C(*+b!E`]}=>%YkV/u8??/5;PiIg'sk9f,X<`#-]ko.,2C 7kzי95?0|ݩgD湫zӅbqNl̆hk*Io4JO ᧣~^~L@/4{ iX%N)=O˫vo.é_Q@a%Ph -3r{rO<Զu͍"ORi)$ոS^+=n+vzd*"9o.k7qC{mP-mZÉzDW2"@L\ qBICSO7:ε}5K^x6 шf,Ď'%em 79%8̟˯&y^󕶫vwpEiP3DfQ 8EV`%E$j=W7NPYyː6>suf^H2XP$^ٷ'ESց>,as_9i 8=R??I^޹62Qsb[[p~aϹϘ?Ě5?Hz[SO~钞>_厧w_~y eAP?SҸwRjWmCm#̺SfխI^:JF}.T7JhX! PV #?_g8yOԴJLu{Nͺl3]#A+#:*W nBysZ t,l 󅶣k:}s}}ziޜMZqT;U*Cvj8/^ms'֛Sl6+θ !Ӛˏ}|nWԓ_nfO%`g~f1L`JN=1Sq`S"Ϳ*yZ.iv]ihwimm}|: %4K cRs,+B*[miÕl*O|gz+Uu.P6a㒘I 25L^5{`[>б܀{',d%ՐȠQ''νFT+9+=FI(骓FDH+}f,t+U4Jj[?$AV jJ`VQ{4;lygC-yCs>vo_TQvF qy2ukc;?F{W<}lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUEYYC+"4ς󘟐Cc͆J)l=Q[J e Hd Fϰ=cOÐ tǑ{o)q?SǬz[ͻ.WvjE&NefKD8QQBd+T׷\(v kr@*mHdaP dfi!c^5+B&&k6H,\^0B.5=<! VV}0Z36n%ojr5Ӑ *Um]irE?14|]嫭[׍svHE$JrF B- B#Tt5%9%_oɝcȞpdt6~}ogb *zuNg Q9,?*<mQCI{owZn£i%4 | ƦaͬR9ѱ!1"T1,Cr#K?!ocɷ%jӮdZ&&HvaM!iv:\[7D-ĊQ޸=yGqi~p65ƾߥuç:%4n&wv闢ѕQHo<7^8"]&-.'S!yH޴̥!@HCm8^v|OV(6`i͟|_VZeӼˡwگ5D<$mah0*!_z4j̜d[b)\95͟ɫcZtf_Kk'c[Gph Ƨrawn GfKKWO%IF?JdsMӆAmPOu`Ƈ#p7qGKgWh${ $Ie [!@},laZM J{I 􌄑{O?#)t=ZyD)tk3Cwr[^je1TgɁ ܩ_+q[A9wTҥ^_N 3u" iO|! t='yqO.`QLi&~idİ=z-$ohѨdov?MNt{Kee'E[`9+@"tIzL92Z: t?P&g])ۦ<Zz"Qq%NΑQY؅*r%C̎"^_?|ii]5;ytȒߍXP}@8L8P]bq@,Tև+M2ojo-M qsR9JE @n+Z`T"B],S/:gb}:Omk C9Yسnē1  ¹( }?LUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]wɚ8/c;/"#RC0ΗڗcjarL:#[1`yg To4;;PH'9bbq;) hi%P9 /!Wd˚9s0삀OHKg̃PX00Dj:;2^c6DZpI_TH6#%h Ͷ;3Sk*1- 6 3W, S+HْB@s*)U0UT2eSYeo|/M ؞…un*)UȐW(׸9G|JU)CPioqE"E*(T۾V#'hB;?.ZMK4Zm%9.o%5W hAE~G,B'͞MJ޻k; 5[gT{Hg% $v2\ 2*Pd$K-Zև]Xo\ \0bIܒN $N6rK"wjΛ&Uk(!*P\J7BGCԭ!*p2GO otk=3M_XGkf)j TRKj9P{I!:o|cVOPj6PēIU&F ȀT|NkaDW^5Lg6]Z a! 0Y` 0pmViV|A@"w=ԗM򎛤O !=r ]r#4H"( J4O.Z -XՖ".&<5(bxA䡩 Ў8H2y˞q}.]{BԤҮ㾰{HkKRx 9aW0ŚُZ'`%iq:޳ZyoRn=e=(2K,L@TJF W`"궺-vycYdFrFe4;# C^!h v',$?Q][@iz]=Zݽ I py FY:oЋ2ʶo/ɘ%<(|@|aJȌi aW^ j@|@pR/"Ih]O%hKѮơ[ [; D|#1qY#@CG k9QMQP :b0DbV"uORC&2yd+'T '_Wg_k|1 wdpȸ5^?k|#xdmi'ϔ\ygL<C? FѬE- T*@3:VV(ALUZեΟZEygwqoq H r# H sMR1D@;Yk\(G[Wtm6"kYG I&^[e{*%y Oy{V;׵#:)p ^^X79HPvK=H@$&林?hn:a^R)&NhFی7p!IqU9r S⪇0E-չ#&$Ln*$W?V_\2ce%8߁]#7.'xOP=(χ;9ێTK1G+STGzS-&x@k?w6*ثb͊6*ثb͊6*~bHzWN^_MycDE;rYS4/a$Us?ɼ9VGȞfү,l?IaK^a6ߑZtf 'O2_ ni0ݏ*789=qyNdRl,y4r&ICEWuWh>{'>Ɏ9x℀+Fʉok Y;#(@okvv-n#:N/Q+kke"Kj|]@dˋ$"Pi[1Op #@ w1ewX"&1ߨ 76v69-Ƣ3MnQy|<ƻVyx2*<5Al",YrUFeFcTXs|yw%\Hǜƾ8R'lVLP^VK*S'(9Yf\(]\an|PaMTo$TeU̵2P$ǩa |)[ =AĤ^,FN&vsq"2JBG^* iDĵ=]&>*fv+1aU=^_2- }4F򍙊]̇j7E3΋gr$+f 9ἜGƻmbS%>jFRJsژP SadJ)?@'h*,oFg]Nծ#Q Z!|lU`/? I555P9-ƍ׷ Y+Qg(PS=!\ ֟F2P+1e?hV|GT,"rBT[$V'l PRH@AJ~څKq@TS"R/TcT4 Xm( F+\RSiem k~a<(%J7cZ<2(jhWnƹW{e GfkCȔW ׭r *ˈ='J;t$b Iޛ=74Y&SQ\&TymhnK^lqxO"ı;ŔW10 M]Yߓ |s΍m+(jːv} CR]HH-0 d"[RltghݑBQzvyqO6iϚM<^HӢm*q]AMZ+~uL}2ce,S)Zcx>W?ed}#':Ӳ#akK̞]WZƛ,sG$7z*䀅 ܚ63Մ&x0,ă x<4|C7,&2y FX[\]ܷf_+VhK_CT'XE(G|%r>`z{jqeam+YִltfOէ=#^ʎҙu%94_cښ}WmX],qDFK/햽îWyKqk Cŭ􈉖7Q5MG.L]S O9f?1?̅)nW,S,tGGm~tO/Qfn㰼M7i{!Ὁyw`帣 <3p@sz~ģ,τ_Gn$c4 R+M[uk2FNan#ӈOktXQ&\fYqG"Ax'dfH2N֝?c~/wѴ mw:EiҤ/0y$kקR4]ا9Xre2f /#k{Ao;꺿]*(gӥK䵔Iจ9lv{! r fLD0"CsF[L4zF㹍lzr[#ѵ39Tn z ۈ ?euR+{oGj3Z;rٱWf]vlUٱWg _ͯ˿1hQa.y_C>sSR{u]GXcC˅ zSsñ̆evi[ |Pz (X*z p:82+|$oƥnHZFvuۏRRm ^CNkR:w?&S ,?h$v y0o?Xi؇˸cze*2Lf(8}V7L!kb7ɂĪ)Ĉ-* FA]`*'q 6'lQ Ö :+|]PZ @81W0*>x.B`&|0*):r* <ѻ1#劫Vj7sY)=Hhx`'|e * I$#Y,) @$H#SZ>ӪIq?|Z]沚}uܖ0ΰ^B $,}iy^GM0ԠSB#Ȣ/?/y+ȟ~/ľfZfHVĝa"<2@ZKn2C^ֆFuOߗH.(IKoqc7+k{/O*( Qvua%E,CAM̤Ť.,5K[{YGr"JaQۦsnK+F8$PK?544?/1˿(yOXZ>%uk˖"eڍJ\j* f8㈒朷߆$ -?56i^JOu=Yfm>ks}aVwSskądf5y6_VyfT)|VHlߘnd7nqe cE$텓p_M~db+?vPk]fl#8gd ѽU5Hbv}ao%>m`a Skʖr$JL9k 0yYmՖCJ-Qd&pKl݃BYA2 $~Zph~v} yZ޶4oapʮx(v*rʦKaI$!^ݤe܈jBo8mX[y%!CQEHY?x<\h~e^aamܶoO@pT"4>O Pѓ O_2~k]2͞QK,( ᷑F==X;0c$U1К-'G4g.wA+C,7aDe0"n2 imZ)3?` ,Or"Os:%wSyXFxp'R}N }4 f,#gіs}fc$es i aiW\Xbh08Q1q|8ML,TPWm~ZȔ9` (w0INVw -3E&<˯3$fHVM2@?95;]U.J- `QL ZV" (O\ ˻!.o" rHd"V5.)Lg}*wfhGFVJNI7qM|TeDRy!RA?%%5nM>#q K!fu4ϝ?\y1 䗾^}}5FYS>{g]Gkwvw=V#HxSܽ_6*ثb͊6*ثb͊6*ثb͊hHR#eu"X#bJ31 DnC|#=KG3c,#BW.+CS#..FX72}6RGբKKH)-Rxf;Tqv|ld2!~gKثb͊>/зIC-_ߤN҇Fx9/%Y<{x>|߾o&g{\P-ʾS|jiP'*6шƽ[4X\ӯNWkı{8@y'L*B<ԩ㜛P5*)/dy?PΓ6壒Kͼı{s_j ?0z+s-$̻#P? wOg}c.$ɠ& R3?^v]E/622yD񲔉مh0.ǽ2M&.,6P "G- M+ 6áy֞^u-n>dܭ>`pS[NZTEs5:DR? -/rUg0 ,u(KC9|$Fd+3NHU7؊2@_ޣɮ~h~W[M̽ծ\G8nGml-px%{ I44o͛XS#yPPT&>tK+XY@= i6HJ2|~'  ~ߨ(r,|9$O瓻u5( lo+S =Y0+PSv1{rqAu˭ 5)m$(g7f-y c/DRϿ4O!\]ͥX`KҞUo^G +0VrV@ߦ+o4O'kTqEH ZO+-Aޘv72‹/"4,Kſ6<ٮyCr_qV򯗣&ga毫OǧK7\Ȓ,|SˏBGPEb"o޸*bscczt 7-ތ^jjDCq~p2/Ek+B(K2*+@&6I-Oߗ_ymF˟\It.G?$,^<7B肋b@d ?O3󑟝ߛ:nڞew-lIW$k*ļyr9H˟Oȿ*~VZgcC٩%2;zԱ*%AՓYŏB|DP15;WA3qkqSk07Zc7&ix n+Z3MBm6䭗~kkBΟA ~FUN^]6IJlyPGo0/2kV V-zTT9mӇMri*2{ އrr'TnFo-1]/˃,d*D pRZjiA.d P#ToS0Z69WI?.I|$YXI<1Rځ\Ʃ@C $}1vjwbV¯g- O/:24qPާ(ܬe)eq>9!u>~Uy37}aU7:|%[ni1~jGϾ^*~l`':rՐf]vlU旔,m>`JbP$}8֮Nm;5xpc6|K !{h?:ݬnH:$A:,,?0BR.nicg,o;x#e UG9d,d@9(xv ;6*ثb͊6*ثb͊6*ثbVvPd@Qс8L${11忙Iy>]CQ)hZ4u@ 1fe(Jҹ= 凇xq'BPj,bxk#v2u /]XԴwLH-M&uBSV@$dčhw5{~} b0\S A!B |uJGa(4z{8|$yeQկeQW (ʤ(Px7f:zC #F tNX?Gy]__x? IiyTY2TFq،}.ZYQ66=.\C,Leg˿M^@.?kJ״c}2$E{]XUTr,*E[=綵KAŖFGףh.IIۊ!deuig%/lȼT eV(()9 BDJ^kc cʅ{Ccb͊6*^U yXb4 [L{eg˔W`VƝei6upN튍w8WW^y;˚ܐKil!N$#:#ۺDJ/ï1?鿙^c1Y Y,RcY}Xb"Pbn@Qb >-<_o̿Ȍ˾iv NMlՒ%+yiμ9R*܉vkpzj\4AH >ct-OW>ZgiھAblOy+$7enAF.͉+)aҔ4´] V髤]"//57It 5!XM9B?VD sprcJP?,hj桬Zt%ceͨ9a$Zj_}fc[hZqEj@०_%QIiyv=:I^ mcݔ9`W{$:ji󝮻sJbYխZFtjr~<TB+N|Wgg4O˽Z4CcoY!BYP m>+i =1Qn$}KK{D12&NK,|ZY +/9ckd5xW^?rMwfWRKOSrB6Ú?"-YaGo%2]Y4$+ՈJYumCS&V5lx 3zӥ~sOsw\b/Ѿqog/41 >_\HK$ɤ Ԛ )zg篞 =<\h2p+\B|.DBLzZwVmM8k\J{67]X]SN,,זAr3iZvէ]9$U~']*MϻO8~JyIj'/$6K M"FģMUy/$-&,BJZuI%)o>~wJ@ld/i4KqdZܹ;v2p%%UgV hRĪŤPy2=+l@OA~BYfif|hO{}sdfYfc_()KM*S5qH6!29?8䇗(?.tHREy$C 4@}zق'|M>exvZ;zړ -9uv`/^,gO1=|kN䥶մ-.IvQ x֌emUC՚.2z!o0i}Q$'wMZJ])5'@S?[뾱럻W~=7«;GjnŪ2R"o0g~#bUDP*I7} z8Ab͊ ŪKiZ[O&Zv~u(fBe j?0kJ0k՘qyG +vZ`'0>)y`ϯRGvzs4yCRo_f!QRHf;uR6A<e,q&C4;{Vx 5_-vsmk:G.C׮KIv XX)oY.(w ;і(OFEoYl|ayjwQO+Hrfb{3%@/d1)r]*3k-A5lUoc'z/*UT?*!: YFڿj("Vy yGL-~y$UqIp zTu͖$?s$Of?،n6k2H2v}@玆疮KiKYH P=A}Yd7x;~|5{ݝc9bثb͊6*ثb͊6*ثb͊6*ثUtucMKNX(. IԀҾّQ<DL~[(HEDE U6 #eS]vlUٱWf|UС[(=8RHǩ>O|su&r. =iMV^EؑP2b4ȴO*_,骀)Lkב^ݗUUor:2E=C:lU;nnvdNBX:y]Rb1$3F;֪z10Vm9Zr^ N39[F6 aM#NT[f%~k}(|dZ-dڿAΥP L^ t+v>-PrdPKjJ'pn8-CyT[ǾKK"M;dB/*tJb>g)XHP&L֛3 QE=#Jض9{1b51n0j ; )e\"VZĨM)$g%J|pD۪qTɸI0`zۮX(Ќwt*bi_α OM>5A /^G%mz߾eĜVv,d$DhvȽԲ\7^ߢ-K9-E]wċTf:Bj=~GqGlV7r,Ji{bSL#H!1830_< cvĤUBVaйv:l-{!wm__6뷩,ѨѦclwMAQm܂*;xCdS o)N'mZƑ ?U|er 1]6ޥX8l=,N3_>ŰEԞ±o뀚X_̈́^?8i^ ݏέmi1AMliIKR ,,IC2FܸҤ\9VdYΝiXmɆ,#`}]j}'DI<|I>8*P7JKM-69y9o]ɧƧ ZH%5aTВMKpIfӆ6Wx 4,L;7᱕y+\!,X29IatZI,NB&>IA bD2AQ)Ma{y#b捵RV*BU5sPt(K1rw; *8B*sWڔ0IKG!FB;N!6Q!$D˹ x&4cr|@li LIZ#14m4f$G*6v(@hM6Syr8~$mLmi oZ\ ֔8ag喸PXUkӾDH-CvG!7^GօI^Ir,Gpp ik; J- ▓ze}Z gA7{#Qsظd?h&EaV}όbdWf]vlUDJ1Wg "<yN5Xzt J~۞-Z32}y:D~wΟN_;>*#+PB|HA8&9Jaڹvwg8Pc썟݋:DOq?ݟA^{м,[Jc]zin)_Aہ=)KxGx :93~@Xd>/eV`?FIS8'8;hsyzjKm)keX(M"tQBC8tB>(aQzmfqoQ|ݞ;|KyvB֬OKHH4qJq,Wz=U$㔀fLW+6;']4DdgOYtꝃuąA>C e.P c_2l~V^A=A Zޠ]}0R^̹iD18g{$ eC ٳ췕|ѦyGӵn5U**FSA>I=Ib8ec!?0hD"v#s~j'ʷZ󆍦 +N@G2ȧ;:ŏY㔇\Wm`)9.cGZEUPAT*j;S PWq_(X ᑇJ`omFIUTnj%joU nF;mw-96%ЩGŘ6 ~fąˈzᾍ[ühSoŚ[8XVjv޵AY0  kpTN'ڤ`#൴w5.[璀$WQ;@Ĝ,'ՠЛA[h9.GSօY)J`J/Oc[], L бF4_5 ִZ~i.,Ȳ!#b9)#l M :ɨZq 1-8ZE8]تRz h 2:|UyKw&Ьt 8&;|j{xd]X%$W+b;oԊxuJU:VWc~~I []N(:D *E#͐yzj998$`wIZ+l N{7 2ч^`92 VD}@w>_p\ Hj~$f 1̺}Jf _FjΥBjP=Nc{{MԭnfuifG#lHdƢ+3 qhn#OPE}B.5ZS*ƃw{oe&U+z)`Н*6V]6ys˼pS 3,/6 9}]ZHZofW]PTdvE)%MA|lpef~L w'k{y 4?Ri$KH@^Mι1kzŮYcO+(AɈ=2'22ޅi#҄CM~G.,mMԞrjX<`%(EY$^MM=HIoY@_Ěqk C$qxdK ˭Z]Y [AIoCFRAcL6 T0;R ֠Β3R74e$F#=H4+OlӼ-f =_H/¥yq&kiJ&Pcl'+P#NƝ=0"TZ\Xz6y`41Gg:fbOmͣӕ%j#L-Ƥ{S)tW}X-y6 _j[ ^ d }u=P׉OZ KΣ!ض#(DdwE,yx׮K1FLHz5ܠI }Eu+0 < b*7zf:rۍi b/]<`>cC2xG0"\Ku5:A@wʈXb`JTnCQ\B8=цw/ݧ3-._p" |3Cuq QAZ}] jzf?+CnǔG~z}W6Ǚ#;gVygZy<)fwJ378ټ ^:=Lp5CFsbO?;<8M9q&>t>%͆#TR5f XsWKbA)P`@t}PGɰϡg 9|-jzey-6WT$OIU^DqZ=>hQH_>[r{^1)B ל3E!y8=icxmf,6X?jGI8՘)vs79t;v}ϑ]vlU~70M㌠? ]"+! iUN}]>]'G4@Cj\ >ӹϣW˝>#=J3(alEQcR4gO\Dc<&y<,@5aGΗZǓ廉n 8F(?"vf/tŨǘ 9 D27HnS99@ ;/D^BZpMImHad|EO=Z)Hs'UΟXH̻]_@/6)8X\?hbm Ğwvul݃b͊6*ثbD4`y)*GqL~Y*q*mߡ…1v=IZױVPt-;P?Z F(זsb_Jɞcvk?VyJ[ז%7VNRBQ~W%{[]a5w1?QǸ -k:-J7>;%]"eqTaSP˦#+!ARU!lTvE*g_| kS) !P5qV2 S|n(n7pB B8S`0+DiC :0[ ¹&*!1ABRRm[Q.<ߎi¯ǭcߓ>h_)`ˍG)`ZmvzMߡ!61Ee5O` .__~YCq'Nk;nmkvqLci$sIR*z. C~֕'9Šy7Q|qj5f}IF5X*ɯ /9h7_SMqǦ.hci_ϊ+1q$FI94-8kM6yi5)ء_zb *#kM,a#s\*ɟ\ھSw]CKjY4 y@B)JzP* xp#ZVejY-6=[kA,WSZ@e(@f4cDRݾ&|+_{W{h ~؎}9nGח?k?U@]۹dNZu(IKec"dF),b6 cc\AwrCi-uh`@^>1\ Z-9:Pː:녔qڭӌY4z~&u_aw ŴuQ`꣚vZňK=?ޛ^ 2 WЅچ  &^/yNEϖcn.@cB2n;Oa6"UAݷ|!XcL>Unpiyo]z"uHXyHJ2bŀTT/ɿ-3y'R,"w -3\޲+ q2efF^5F\G/#\OW6'wU@gU7":8h^LJhӑ7,Y8rc'>]5Ώ-_ffX$&}=.}5r5f{5LS}XK:Mi'dߛco4ӡ'svG=Dt =RKD_u _o)꟔z+˩.囝A$.EВLI.mIijBdTS?8PiօyKt'ePm½xqDdC O/P] ~vku^cXu/둩\h84 _EITFY#`0YyaU0HzpPO.K4F^rwrTu$OkNۃd> a` U9wk~xVh:&&&^W&  \SʜkJj‡[k?~rhHeenp{{`DR|X?| _, v4GzTawQdh) xSB;W)I*JVO pnCcӮYlJGՅV`.BѕZBU{1<n۶B=(TrS*J8қ k^j9h6B~dVUR7l "I@r$"յ] _jZ#d(npSNEX-hiAT/~1R9 ! jFNrը1zc!;=>N?DaoYϸn͊6*ثC̖eO3T{]i_ 21|I%?g8esN9 bwϻ=O‰ :|H|׿4kԂ aoi#57٘NlDo[qK"砿Wij!?!~CIVI$M}xW\袔E⣹?E;o9=(G#=K=}ggeٻ6*Ϲq0;PN$[|}&P#cM w9Zq~g>*}^CyԴtev߭"' 6yOiç#Q;8WMx?0'HvzJ;gYOd?S(d=#ݞ _7'%<E%SSFۨ8+;4 >?9}ۯ;?FViYZi-Q((EϊfiܤI$$} /~u[%k>_ه9PiPFlFUW0G_vt_-]2{{FJ٦! tH,0'4EZ|XdOv{<4v,,qƥ؅UU$u8c#CryNπVwryVVcb=7ec!E scLKd8R 8AȋXeo6x<@; |8C=sAnuB=SMIUW2G,akRxP=i\-n)Bǐd".Duߓ^ogF^D;>Zz6Vv),1B$̒BwjcJw'|6OFTh ;_x@·vʙ6*ثb͊?* psӝ=E"@aT+QX ,PaXU2KiXۋ/?<,Pv^ʼ=OluW=H[joߓ懛Ah`X.PT<=k^V1nP diM`q(#ZJo㈟2r! ·q~̀n=ηPjH oPva*:囍FfOts`Kզ)[Jik$XFڔRW*PU+[0ePጦUJanM}Kw/4@8mq|1>韚~b"ߒ&Oɪ߰'C/ɱy yqW[_鍡8v_OkO_^JI$}?BWݲ]NZFpd1(RբPxIVp^ (RE{TVkmJ<bGz\H pgB;a5҈c`:!!z^tYcu\_A2(T勘4`l2ӯ,l чח%vE>#[GNl]j(ơ?%iis[N ijrd1с[ywJo? }oMԴF+;{y6V5Y#2 D4OXW^H̦u$t8 bz9 ?*=%Kk1Y6G$QL'ch ^[uΪi/? ?4~JɧG5 B ?@IRXԴW iz=ƪBƴ^zqߗV5g< ͧn ,Rh$º]*0JkVHxaRUأO3y%*?/0 \jC5LSM܊KMW%[,좒O;e?`204ɿ&ΚEѬ1t2 +@|Xv晥_-օn?xWW&7'*~\6<~z@ϚW00VgzR󡈫$`*% 4t[4SrPI[tوِ^׿;#Mmu|dluK(%r:Dm`X($ wmǾQH5_kwXd.,n4}X- 5QB*,)X$Qm''A?Gr -:ʚeyz[Ȍj[ka8G4|~8t!đwP1Ͼ!.?3|c͞@5ȼ8Rmn Jmc&$ 'ꈰT,(:ָfO<MZCm"Vg2R(VMNΥiQ5rI䨠 đW~Wy@#<\ZV- jK-u)#O |=+$<<ŪXitIB4DK٤V-X6A?X1RzԐ7 Rm}nwr][u&:͎m :[Ģ?i܎HAczmq6Xc2BBִڿ,dÞVw/Jr5" trnL{}+!+z ýr*'-;a^k}@y>u2%$J~Zp8zdg&5IW` I"GArzTUCjNG55lK(':s(;F뜒LLT75P^0t8JtϼE濦A>!zLo&ËA} ~^JC|b͊6*W֡>O.cQcF HB(R(~;+oecÒ/c O]Tx=G]l_PVz+K+WM=f=C$G+_L> 8o?z%·KBUoldBI=vίMg2ԘeJC>GKM^mBT餳C`3?nj#qԀR<^Q؝-3ՙu;7m<_SmeM RG,NFM-VH\ "#Ne1D;?=ߞ_>pսZuʏXh2+\֮ (?@*>iLˋ.]7ܝ׽/qsqN} Dw^`UmJE@#q$DI|gU~kڙ[Q# !3< ;<9y1Zyk_s5;C2 (cJ@A&&T5Q=N]xS^Cy+>}00ԡ[^#(ۀq=襡,3(Qc`3N7DX[@Yzy io/v_`~}G6VSZt;+&?ǿyǰemUrov~EWF B|NE>?*Ѷu_/y`KjMBO:3̱cI>_dXj+܏_5V%(ꗼ>g quzWzz}( v4) '8n5_ڂ/D|a84]e/8%}Vqo2* )}Ū={_vnZ`?vnG|WP/FPw6jvqIԌݡ(!qw^bӃOngK7 GhҼ4,d.4{ۘf"TH -UU$}OuMYx1q9#Q*7ߖ<'T+ ⾜F]s̖2SA:ޣ2Kglx)uT;Χ2F{1LjU|G{69*:F;ҙo4mU/Vv{7qrNM^wLzcA-OFʨOPZ>2cdVsߣWj(DLxkvzw8Wzثb͊6*ثt R~"o D~0>V¼zxx|} ^ qPQp;q$nUB0)920䝔HD3trwh yllx:Fㇶ c?a'dBa-\(Pn)݅FDJiz,Q&AJ;oQ2?W(k\sMrI=Ft VQ^EwFc&Qh:iwl 5*l1'+To6–Ȯc]U צ$7/ir_I41r#cĚhaQ8#0UӁ3\? [lA, 'guMY NB5< r2S40dn9[{6H IO!G۩$t_QWe=OщM,{[!Y~)'M/ҏ}öӡBZОU[pLNW;UAAJ׉ܯCb@zcHBң۶$wܟXT8-T$w J%zWekQ:m<7[n)#:qh8P<: G74Y=1ij0+6\dQN<-ҭӰjMbT?hP9uढၟ'w }!,3ICᑶ$/Mjֆ e ,悝\ &t-]?Mi۷4v7Q" dc*KJYI=Eve;æ1w;~? )JǦfSOmJv5zN dR6ݔpS'Q2]:3n#jOݒ-NRḨcĔHKʵ-I$`E=FI BTՑE1}#Ct$ht>d"VoNSdeZd,CNk^p"|LM; L[j$Cܵ74SNFBQRynh'0x>y%խ[7_0)/3y۟*;dbE791>$e(M-b:Y´m4 )? :u *WTu[yaIOb}PqTdŭQu6p= I]_z܀PĽgN)iZW6B|"E QjB F4ߛ28Ҕ'l[S;IcW^ Up{8L*Q.:%ޤE/ٚN Kq!R惎ڸQ]xTqRޥ\(|$3 9-> $xlQA^L(HX84I" n|G?bR韀N2#xh(J$:hԝ|iLdcNj `74dqc'ZxW%>I*"PM D<|v~gvlUٱWf]vlUٱWf]ehn$憾]* ,EEA ӱ91@&1{& d,?.0 nn%n(]-D"#dh5 ?gɺ.9,ׂAoI}|knTb +bkN5p?]\ϕ;[S)>Q1ii DC$qF*(|o9"ldϖϛi?0<|ơPt_0 Y~{iIpO3wm{Aز/~{uh___SyR̗V[ 8o-!& 8j=q&Ɍy"'Ͽ>i[Q[o88O0dОss^s_`,gi+ISsRS?`p q}.UyvWfvFM|b7r/w/GE ~G􂯀 ϒƢ\~!7..+=ew7<1ҫ.}8esڻKJk{xo#c ǽކhac(&J4~/i{7P "vv}_#ZWԸs֓x}[SO|u/dO;ֿppƽ)UВHOڑ1XZfi_roW>͇z.reN"7PFS.qȌGr\y2_ͩ eokWx}U>7IyGȸ1=Bj𭢭FP%޴ҿ7YDtc Kı.?P}]` V$@᪭vy#q/k)X~NJЉݰ=3At㞋Q1^w./'졟?ÿvo? WGoBo"Rzԩ[58AG8W[c4_kwwoGu- 'PԭmFō,@kRgv#4fpc#Dt2 yvNT6*ثb͊6*OBcOϋ#eP)Mb!$hTv=^|QhwF+B0.xaCXp'ԏ֟#R" u؟lD$P,[H\IjޟV1-Uђ(plTN§[24iaʱ\H`),HAVSVS 1OlA(1e9p8U\N#V^jl7zHXޣ#QԚ[d밸#ģW4ʎ0*|F,GøqT-u;TX r]υiɬ\HThRiEǥ[V&W\$'Y|m]t-؉%=Tޝpaq݈dy_TF[ù W-H㜃vRu:jumhsO-6\'qcV ^{ԄpuslS4iBG5 ZmسzaU_jtT,OP6Y(Pc]Ti1úDQ]EXT{/fj4aX[B)P?ss,G*1O(]R9>T> -;G{b#pwEpZ@^bmW5z_%:Em{@4 װ8) 9GQըCS^N+,1 'y#Јy5;9K^'.d-;C*) =rkO LcJM{dJXl)TRF%+&`w9ghA#b:~иQ]b;]KPpsNҏp4OʺFh}"~]>V~1N"#p]O*4yz(8)M߯ d*z;LEdx AQ޸ BF=uq S ~Eƿ,"/]&n2,9y1FJi_Ѽh`ĨePkx)ZҴ\ &~tb{PM?N:qb n|TVO|mOs)kl65Aؾ[96Z@j'aZzLQzzӱE)=M.,zdPYi\v#|R>5;S3@1U6`\k w!Zl Ōo(XIOrAl2 S/1ۉ*W)]s瓥`TRȅ#"dF4 z׀]\Xdwocs{-f4>e1 @#Px`6* t^a yɺ1TմdޕNjFh{wK&l}e`{M}v'ݟA7f]vlUٱWf]vlUٱWf]vF +6rٮ4W]8] Z03;CɡN&hJ.R4g0GN_A8۝Vʖ.G3O;NV8"U%~+^j5=<(hYwh/پN뜣vlU{{Y5 kU$Tn;dP$_=ؘdث_]umD#$| qTly=omv1|щ&l~fߡ\wU-_aQ^Q3_xciW=»Ļ=88wB3k7+yD(.\!FeFH~"6`|ڿm<<@ ٙ/~a=)Vy;6*/0yX2"K9]XI=B͝/}ǟMHly;KGRԍpW06~`A˧w\j:|i!chXx+n6?_vfH`$ f1qgxxOwP_ͯ5Xu'KimueXX+FWo]f/i@> >EpH#?e o ܙB$~YIzQg5KPNN.ؔdP~7GXC' 9;Gf]vlUٱWf]xu$+C+/]1sW`ʟn'5(Yw!+ #Tv8P~xRP`vX${RQ\|+ҵp1CT7[#wq(yb'ǡq!SJG4}9xQc5JC,qaFGv$iWҼ)幺Jz'q%ќѵ| ~ U ~t˂HmN4A ; 2䊈 ƻv.(5ۚz4ڿcKL641oW@!`a,\(vmыWԸ7"i|lo#Znqdm- )cOrp(=8%dsٜ5 p}RZUUqVשs]nZjvZ@t P .^Jxv3ۧ|4L!ٱ.Z]Πi D">U/mts2zw?!}?qۑ$̊l@"{yb̓_ D/$5ԗĞ۱#zM W +K] TK u4zUS"|%b63m`vMzCQ?G䔳}G%27F͍&פR@e]w>'#79*ƛ/AрT߮&\h;b2?T}9UDpֵmT%G=@NEP`)NaE(}-ӶN}Op3Gf4JPi;ɧgX-JxFH1%ůEirs/0"Rhhv/Tc1zK qflsp# -QV7ː4|e2*6.@铀HbXC(vIf Ж>#ȧ1cu򓒊R>z|*4NEy.ʗO`=Iܻ:-o 1'SlTLKRO+Qk]ܟ5P*jǠVSӭR)!AԒ+PF3nI^JF!亮`a垟=§EM$bZϘ4HYkhjzSSv n6MXԼU*hc|GZmNuvQ݀HeL=?*]-ٌ\>&zà혶$VVو&qEcwI E1 U0؂qN%E)=FX*cZBomr=0U= pjwbX.( Q@}Ȯ ŭzНP!,|o~,RZOӜ]|$(X@U<<,U1 LvP*UOׁ.ӏǟ|O0zPm&ִe'd >u9p~}Eݝ4kb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊<8[AeuF_Q~̌8ʣhp6l=O6q˗~'C=]_[ey XilѮ]G+cnGz+?y,Ox'=>D?p_weV׺sګ8YYKy'~ǷX( UM=wbYDL<ݞ 1$Tú,bG'9"W6dcL=o՚RKIcR(jҮ~CbhG9f{(ŬuxD-)w?Go+%)V;+bydLaOH.k ʘܞi."D|tN+aZC*ͨSE̠pHU.O8iVif byq=SѶq=+Oð8!Gș*VҵO,1EcU߈F8nd s5`^ e͏k4T Pk~R={ OYvxk4VܑWs_*|d-!Qcj W +PD)BG"?ޘHPA' 3l[THEȯ4m!p%efփe-Z 9)GAc1=WZ&rk;;d^kn_n2)4}?J"m";ݛܞogMC /i(M{&rY>[$T;ekKmv*eZ$ !>u/$|h<0/i)uoS_Ǩ[H Anx#-c@ ~p-1b)v(dU'#]n~|~_ngo/8E|gPWÖX :c:X[8͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*8T2 Vj$LE?'ZyCLxoWJOz-˅)ޕ>Z5wM# CZJ7Q~*U>Uv2(vS?Gj⬗MIXeCRS]}ޞ[,O' %5hv8u? /CfW1oisVRw.#›Z'6ټߣ>*|QʽW#L)x/&#)Z%X05̧z%ٹW*g58c]vCG݊v; Uًﰧ\Ug(e mٽbA_zi,XԱ]+]Co-aߊǕ#LSûo,_\PiV;to|ۦQZG~=2Ekcy t!N.@l<*prIL^?cП y* ;Hej~VWyw%,]yKh^N*eT=WzvV$נ z0FAҠo~ّ+M[*4 KNI,%nL$^IJ?5UPVFs&]7֑&;l?϶Bi0mt(9HxP}>8MyF2&t0ymRF?=NAa9<(2LTVS,UJDijsH~Z߮SSgEC B2|$f[~,&؎jnH2,0{i a=qIbJ%coZw.52HcSlᑫb:DnyZ >u?,YiVj !O9 K?1_ [Z|\]4ڄ0ʼnG?i!h=Ȝ$Df,R ow"畵z60j S]OzcL,4kXO͜C('jnDu,|14@.R&PWY'q2ľ,Wmk_,ZP38!Lh#-F*G|1Xm~(P79*]Q 1+49+v7:2@+Qɺvƙ4δ_$q{/FTJ 7ܞ#B^[h~]I_RpۈA%/5O5yN{(5宗PS(1&~iVfSJO jez+*했QaaKnͲpdi\j~P͖5BFtUmo`F`Zud'OVM@ܝN|i (&Iy|i4-OIdr-զl: xVO0EJ=\:{`TQ#WPjZ/(GÅ!fF|= ҂MeKU#0ۮuHpG7-V]  A: o Lb% ƘU0KPmd<܊aS-Rd)hd=LYr$6Ƃn*Mx.%BЁׅM ݀ntCGj$}X 3RE5+C\OF)Sg1慖w'iiSQ;N#!WRGK5=xK;? OK^pL-3]؍W͝JW#t:#qchI<hX뺕熢kZ鷱ڿ%kH_i1we=CQB~tBoks"6qk@ vr)Ga703Mqmh:,('SM"ո51?z`}or)!C^ uq 2b}>uN܇N&+jFhEofOL.PO%/xOMF'ꢎcu MOUL ^hbɣ^J [v4Uk`xK(CP(znت%n>? 56vUeVi *NA( 6;F ֜I=\QE'Gj L<(O;fvyrbS"aŽ$wӨFkU5'ڛp[W"`?Lt[_Pw꿍1O"L6pnf)'ѕ^yfߎ!9"S'ȧRYXQTx - On/M[hWjҀo*^GcDcOd444m)` =7pU4;䭘2|$Z*|#Fo5~-7LAp9Rf۩'k(m7C"wj NTH5/1زX9 xPv$lH"uW~zxJ%ʻG8܇Bv%⿸fJr24&zta3DϰΉeb8EF ŔcUg!Vnw )@(2,rS,\7 x vcʩChT̠;DkũQb^((-*O$NJřE,tNl5R* PM0A')9 f#HVvh<.6elN2C;ؖ DhB5. Iv@Y~*ź7ȕOFKt_-=V/OTJ^a:Ӟa/qP}+2ZyLubś?~. ߫!ĚBƴ\(Mtѕ;WUdߧ,j}k_7,OmlPY$KNysM,M¬v@}l9<@an4ݗ&ƹP^GYҴ5r1Xm`6k^'ȍřzx.VAU w =8H d9eOj>yA FkY #8H]㑖*{eLQw"tlM\o׳v.͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbϝ_+}+s~dZrr:({Sr?yGC^ڍeuK~2 nԖ_GS <#6h!Md7~4"r 31=/O揕ZߥbB.@ը;s1y}˛&}FӨd{0UNΐb;VfKB ȼw /tܣBJS R>N>!.%w-l_7䍚Vi 6MkJ}G򣼶Q ByIq O~V3M LUn'QSay> -H-FQ(('\)Rw94y-..5]I۵ݬL砡6YIے2ӣw枉-\=(I,(i!z+O0è-E iGJ$RI{[k,^iXCsjóK>Z9u+&HGn m;n"6߯ƹ hyȽ{J< |m:s`TRBǖ/:nr V;Nzp4(2 eY7z[\DⷞbVEJ`O_˫١ Au}>̜ȝ0^5Yux1I+て򾵧"V)R~8?/O_֙t~ cZ|.45 @~ښQkďՐRM#^XP3uB < ~\ˆ! R_wM* C2d9UmSVدFyZ>_FRHؑ~v :VS6˒?~%2e4,ݾ>:NXjqr?M d?_B_䟬[O.[څ-9iݫ_,;ᔮ]l!ާ};l.֔s0x5T_XlN#MO_{JkUr[E'?4Z_A=S5E}-4?4o8M2DR|{ᓎ'?Rx@KzL.gGVkt o;{c?Kd7xQx;ü}/1>Z^ϫi&6s fq?~[X,VTD`jnrOY5EIWGKnKʰHDOYxRśqȟ[?sZybx /);=[thv4Kq{l5\AV&:YzdȬ=8Lb_+Y]īAV;؄ZuX#y.)J~dg=魟M[[Ŧ?#rKS8m+}w\7Iﰶm7!GnXW4+xY=ܡTskjztS'ѡ~]i,Y_r@ w- c̾򏔼gbPϮ IAgf ;;kc2azqG>s{kP b^ *Lݚ1-ւCDS ??,~Yie gP0_H kCY>O Px@ԟ3?.UUMGPj.>NYYcA'Mos(Iߞq,g4]bPաki299ރ=SO>`)edYЗێyO? S_+`żo,漊wgu|5F[?6.Ha疤yUB_Ͱm8z=ql>W6|V #؊Lfleם~Xy׿o)?,5n0[;v~]ZZVnea28#j~evŏݏHK8?/oZPy;uL~=-[P(~|G|~Dյ>mz4ˆ X'p?2@h~^C@Mm/kB+Z}{7y ҧ&otsx~d]]@$UixKo@GiJr-SWn;)[a׶Z4=Rs$m{hЉ>"rGEm;?)Oږ!4[X{ qGzp\z9=NJմ55hRJ\0 ݀ J5h#dY|^3cuBzkHtppG/Ow|{6m+Jy`i =H1M"&<$bw~JG|Lk茒-͠}>jußTJ/̫6yp ^1QZϼ?.>`uedY=+> |[~ʃ@+e<.*z* ]TN=MQ5£|ʼnz!sokEiԃ; xb޿y? ΣG: pfJ[$v(A9_C{!oˍg~똬t/-ikK̃BV‹W}|䁬kVcIJ#_ʏ?%m?@E|=~ks t!xYNX#|W|I?@ygrDrUuMtҿڎb](ĬxT!~ԟ^CԴuqKQPGshgL\"|tb[> ~c`мFI9QZu[bS:;}B? <t= *~=M$i|+Csi9C[3T<(iQi}?jpȧWYSڑZO;|`w@~dB?M Qi)w84oj -_G d]6G'W ~7bTj{=w89(ڨab|7j~еA Ḟ\}FwO(~XOQx-bʨøȞ'+_&dP;f-4&9>Cwũ^WgXj:0q+OgƄ ՟ne2#z[-8Km_l< JiLsp4tOAykz; ~_BY:Vr&+gBC9S`^$=DrjG f4Sg!mg  @ӈq/R!mqR>2. Ǽ>?%?7<̗vi=(eTdqf`H=EsW~Kkҗ[\d!вEj xwYbtܗEJΗm΢KM5]cRjz|M)^sd4"?gyϧy*&ԵOO4\] ~ Оg|8=fII'xA3$sȍTBrgO`)|AjI,HWW!>tOK%!ծ'hxGntW rq9Fb?Sտ#!o4OhV"(`_ZgcSS КgTm~wzLפSm0-A?rJ/`^OӿZFb\S,m͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثffI=fH.S"#ݫ.Q&G|}'˚ךuہupOxsEEsqyR]e63){٭[P$p̠ @mfvn=#W'Nɵ|ydΟ̏]sYu4j0\K$z]ܑY7FUXFP $=͍4vPm7zxG.VLhfI%~`75Hg(k_3yH n#݈t$R}h-L>Q_@# }9@'2A/62?3Vh$ v5J 2мis,vlHePur CXȊіڜԩW9aK0r$P|AܜY NI^I5.52i4X(U[Nn:0;0`m>d廅֬ie72}Olp?厫?#H_ X*Дu0=bؓm_/NխPaՊqawV3h[* =tEuGM0-R yǙֈxR{׮p_̯ˏ6o0{Ny --Za[ ĵKg~[<=F#ix"?/u??2zm) .aPOPP=$q:'VeWƂKiZR:-ګNZ󎷰| Mbi˿aE˼)w/.>\L<`w/+'֜nӓ[k_!,d5qG*~y~W]C{ai\QZՍr'yZ,]jJb\:d25>O*cy_o:_Nk#[ ̀:}B R 5n ?ՐmCɲdŨ#~,wvcOV!J*:/^15vMo1$^u+ʩJ'Ll丘Sʶ gb`irV=/Dy"*chusœЩGQdLj"vڳN?p=T~E_?}G"dU_N8d 1k""2yw7Jh[ZcqŬ*+ʊ n5PӼ[O'JW%VVt DƎh@+T9jkMv5}4rBh8'z@z_.%[2!(([Pm/v- osUkCޝi1/?Y~cYh4ۚCI(XvvRZ2o\nPNM;ev l0FMy7iGnx+Ĭϊz zm<$T*Hdǭ:Ȏ#4SpGݥ%UBӴh:W5؁?%1. Ş^D`)R>[7- So/7#1KXҠҹµ/mOZbגHH( Q,}/:kEZ_Q0zt T|yh drG hJR ֲj[TBKV- Ɍݬ Ҡ[]2+x aSAm᳴ oeN>f2V"drYj(6{x>#R :S2ɶ2L.,v83KMkwzDշVRbPrUbEF;Hr9~U&K{vFl[=F}7B6Wx8W=,`?DKC&6#_ՅOmerǍ +ӈޙ&Nѿӿ{AvaV? ב۩ с4Jxl"@ gXIbP\Gzi/'Ӻ9(E:=7kPNٙߓžH]ּG|FG.&/e#Ng+pb4^e'q)S n26Z5{ɍ=CK!FnbhPlIj֣rhC<|F"5ΫtW O¡@A^iӢqA()v1'=~a/o]ţ50˽ o0q^%r;=V#ֿWzG?~/.-ߞm7N"bEjާ:q4 @~S9+sxaR~}\jV>4nʕmzxW 5 U*f`ǽ$3pr#suBvֹ;qjڙ\{\C)3k[2dW'|iIfl#"tkiBN{0kJ^}q wsg߆T7}QF4 ʍ%]6^ؿ)tdp~\N9q ŷF<_>vŴ7|(,`ḇIJzS_ǧr恗tr|{Zl|;V[\R(i]$}z9_K7mWӰ-*TՍ>rq:~>" oᑛەphHb (:TKt>Xj*WcSsԟ*A=mL#С=\k=CIzma^: J2;v?☐ƿyT{2-(_QNZd*FTQA/½2#nTFmNER9+ZJ7x,P (kZS#˸nٵǐ=C5vdv5OlˎZ .#^8@IG{dX~{wZԂ;&*BǛLj_o Xp]-jZ|:$x#A$*Yo+:WD71dze> 6'ٺxoͯ74.]c^bq5'"re]jeՠW;ED43&@ǣsPknIԊ+[5?ZI1JѤ-Eޣux6;qq"]Jx;BV%X Ł4n!|G|ҴrCG!Ҕ~hM// RZyY>z|~ 7 AZׯ^_̟M {F%E $B˛DE?!A@:37a ̪2vE@(Gpk,Ƥa/M>PQm+ 5P9Xx#R؊dsYKX51ؔ' c,d1D9WjTQqnq K"4h]FDdpÉ$6QpNtu=mrS@l^0V⭱`*='"ạ%p"-Vwg7f;jw}JH!,2x?Fi~Rizα46ELY wuƦ5-Ken̾9c@zS|Y\!"'}S_ɟo`_5n.T+ گLk ~GM?JӭT fEIZsJ%3.o??yRmOzާs¢ ;BxV2# .&%56 6ESH׼@^Ȳ}#4ͦVwv6)i8)6c4BS:Fۏ* 0>,>hwgиexd,SJV0A3% }B*@U#rS]ӣUE(h:Wic"DsJV9DeбzϦHMUiԟpLCv5^# I{e~lGZނfiYTIX+Jv-_jBkևi @[FX;(p%N mVd|?!y  W$l/'zwag/5ĒqE-؞02ܟgOO֭?,>PSOL79zð+L:巕<V:q,b+mU+׍M;Dqv˿o9I5Ϙ4)*#>ȅfeoUPkVKPJ+ _s^̨t%y:j~(aG~'Pupg۩Xyɧ41H#/+~;vzg'l1@|-—R8eK)&iur>.Zd^GAFӥdTx጗T8 A#dǖBK<1j4-R*9SF  7d^<Iq WѤ#$jHJJО#jiEȎP}F<1"T,b+ևm el %b&YGb2D{4.mcu?'yO˷W oy昦@ Y!4`^c>k6Uh߽c JQ`7s[y: /G(FU}i)E}r|rrj8.<^skz#M4d4}E#뛹J'䷐ER u s&1q&xt(?/;;{W: jaR*ʇ0[yHu>^̜ԣuHx031.?|GZ5u_iWH̐9BQԐiU#+Z}ĺ`V~Ɯ)Bڦ0#M'r7s+3>8QOAd#RtZ5~gA( MG#T)SQ!#iw N}uuI{qF K PxM)U#IEFeV@H}#?ȯ2jVT&**!ڍ dzO8[,mONr 3 e8Yf4aˈ#!(w8!<Qxȗ-SE;{ey"[F A~DjrIn̲G3B AopcEi6 79sRz(6!%x?,!@6Q޽`0z`Q8ۃ\ؤIAPf:z W;QA/LZv}rbޛƪ ̧miΐV9ΝbFeEi Nwj(MkNLe7l6xUhڟ029Z9MI`Nt;WEzfOqdY4":FB7>:ٷh%%`#fTrHlTNՠe[tžͧE"Kke3ZĊGKWO oP{#1Dw|_PH,E՚8Tğu*zVAϻO#jfֳd#bYjzfs@p#pΟ- xf:I64V-\XJm4;k ø;%ԅ9/o_3QWqjz)IJ$muWRT8 E>fn+;9z雬{d$+Sd~zJKG}3mհi"nV!oh  u\zr|Or<:xYz CA#qU|m͕;Xq{w='.1_ia*i#_:.$m7P{MmJdS~"S2eߣ>j 9ȸF(U6gt/6$£D GPw"A]Y뚇BZLZ}y*Woi/!i܇5xkd_$-䟉eOp$|L G-IFf3#WgWvG >Y\f@RuKJY*4k@%نq_'[_^KgX/TVu"9Iskُ-y3O^elt伺Hj l'>~K$}ljXҀ wF!:@w{s~TM Fti r0U^K+,z]SƱ,I3'~Q̟p~|?󐿞_R٭.RK[8)S%;wn#EC%X$-)S{f6]~74nGO;O^h&h-%gz9ie-Wz(OLD`GUzd:=@#Ӛd2.D>iu1Ж^n!YqNWIIT+:};.o-F9 ĥ&-^T=7E_EKFH;̬'p\WBR> y- ^bzIȲ4Ҡ lH/#Z'æp:,h*҉nP%FcR 0p:zek Pcu 䠏v \YCM妛<3=Bm"+7*lIZ;g]3L[xVo-%c/Ʊ%ijHC+$ ۟0^㰪9v4bzLw~n3!)nJ:EΙǯI1dy2M_Vme4aA?H'm|>sqt豀Y>Pֽ3;L}G2F+Z0`AA3W.m5ky,;Tҕ[|vI5OԸ( UI$oOKS6Qo{j[|jh݈c^Knm)m!/Ga,u ~cӼݥkZM_B*tdq_;W$d2"@1wp;Ff]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWds̚ܪDBndx{'|ËlP Dyo;s<1cIjf ysm$#Jۊ4^U8J܇ihf %К4>DFy0.S:EޞDvj @)im:s,'>o.9.Vw-Z:*()XWҔ?dW qKE6覾ZuGF71ab+j>RkYyಸxM(NR5TZwl(qcE8]ys=A~ Ԛolax]]TH'0N8aBJ GpMґ $}h4=n񐯿wXϟbeucCwuXM-l^JIB1B{fg#g}PSΟV:4 Z2”֢g-CCI-,.)Jӯ(3!>|&Ze*=IuJ(Ԝ~g~}:p,'̡mR$qq^N;wDH[4~ cTEi}מ57>mEiOaƭ$*Z'4CāZm&1qroǨyOnouorxqh7=z>H׮{*:j6$RL2Sӫ/k_ @Lq29|gң.g5ԾhPBv"Y<81Asq{eBixԊ7k>B{I#/+6 {N{~|TcԞTp* B]RoJvfq@Z֙p78TO'9O0eR3si< n=dtHr;Y;(#&GESMbb)8RE6V y<ُYXf2 5/yyZo[3B*az;WQ9l S)I"z4r ZނVBo3M}IV}/FŃM29@@~3Y hso5/#y˿,\O1VZ5ZK-2r+QUWp4š /]3_)^E~d~O-o(bC#:ySr+)Ĭ/lealj ƙ83v>( 9%!FuiRꨋnް+C|]oG`]LEI >mfd|Cdht "73OrYEw<ZLƕALjr~_ͯH`YaNj9 0PN|8?5H2Jde[9ȟ͏$3-֍0+$-m-rza>8wI.DiMP*6; escz[w>54+*+uUaN6vIm8.St_7~=R4%PY#}HGQxԯ4P֪9>'0ƕG'cTdOx\Y8vR.qg+ik>TUdWpBS`?׾o{.!04"YVBE:h9QޛVLc٭W&9eK40iP+Ln[-}3ӚAT b)_lʞ?͟IHGr C2WR Eއ89^уJ #Wzaj F"o̯0/AY䏜yF$J>#jZ.v}y.|Gi ӛ&&V@9ѵwUXtܞ1pLl 30*rvc>yi&NQfP>9hhtqdg<  Yb҄q2f[hpxw ̹X_7מmݧKrE8("{քtyX^1L}B 0jJ Ntb_>$hH~YjA'Gܞ37>w[1 ۳1 v`d6[y=z7-ԚVvYmDPDƥz32!a<?/"4Kwr{mn'"m!0MH M)ڹыAn)9/ /)ʖ@DE,]$߫6~qPTMHΟ8 ps}q18)99bwGŞHa%1'}sݶ{(Ҏ(֏mlc,%:+j^IҵDn-O+0kmS:NƢGi&4 n>27rKX†W#%$:Nm*<:CB;O 90VЬrdjl0=:RI+UEC3܅ 'jzYmWmP~YpY*Ǘ"`jd]Qhr/srzm9Bp$#?YAoNU^lE /JV̪ۜ,7|<PuֱV!ޡ|ߐ9CKɚEZ;1 wPL(#=4 %KtjRI*U[l_:P#7h|O ^1ySפt lSd{\hi.[l1FfrK~xKZxnv޼*8WZP*8#Ѝ}䇜|;$C~6%~54'%+,W4;[IE$UZ笿? OS]h1Vi,z螣X>GWn<[H?ŗ6xEM8L(EPDR gֽR]$UF +fsPrk-ܯ3k呶bjy6Jt //Z)1Vsɝ&&$'#y+Tq/U' U]|2w, K4N[}Y"Q=2zGԚ)яPTBI>}&B;eɯ*ͱt n BEO `d^%wcJq? y9*|1ywZcc{h粻յ{yC|'=U89)gRZ֣滤ƭ-%Q͙+>!Mqn|?#?>Bo̿'X= sIQ#jNzW͞h֖JF1{?A=As%͘EO"sNi`);mxm,$^AV7U{gaG-߱q KW܌;VE~ȾfE5b9=f&"^Ci|qc ?_MEZn{WM2HE;9Y=Iӄ^ !BAcӹYdw:RUC*~#3L? #2W5 A$qR1ؗL{8wd,ʮ]ڵ~#~Qip[,HTbN\<Ty c~_~_SdVEmȦi2HެVޣws,hԼ/.~kΞSh}Mc[8#/΀$l3jw~cYa;OMz1%Q&|D܎ƭJw]8lnŤ 4LG4$ЈZ9!Nr m˽??Y^bKR6z$@iD^n+O >wާamoni^%6UDrs?!2#'_~}\wQaXE>8c/BȦVR CLSpk+CO>.A_Xթcn$.yBPѸ!="}uGo9ֱ[ܬxjDZSZŸ;`~tԍt]زJ.@Wپq3L_]>KlbP"".?Y$7ί 075ňquRcs44Bp~N04G%ytNLi=,xj¼;4ֳ$ahTПv{q;rѼ%<1mϧezıb~>_g=ke>Wv}hchdY#C *#bsD؍/z f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWavA@Mx+Em/A?sFl.Lsk|dڝĝI~ʠ?vqw^m*kQ/`sf}I}1x&yw2ZaxΨo3y>FGB cCb;T'睶byL~d_G\DKQ uHCS{kLlC;Alva*дFj2p!9]G^=:bMimA91Q1EXOX0/[E8ӶCc! 4M/mtIa]O^&Ӽ}'LQgA4'$0؜/'ijtmFWѸ]GSZj魵H;iаvF K ]uHhO:G/75&ͬ4Ρ2 :18"dzP#ʯ"o!|qDe)Lj@0`E+w9 :Hn|i1Yd$}S6#`! ]kgTΗ#kX Mj}DVl-/VV7MMvO\ZyPm2H.PG_+2swWӮ%<-DQS3 wuGD-ѮfGQj+čEisb~cGO &=ڌv ۩L3L"~ShFU$u*>z&36c`nJ|29 "mjX{jBxf+(c̞h͹x! y9~yihI)n.n~TFvY:?CҊܛԴ?%UfDATMw^I-19WggsSS~/aSYE .';d-jY9{EԂ-Tq<~Lz! Gq}o~ai᷵ C}vwhHճÌ9~EyN[il_VvsZXMb|iiZXcTR:x1'ْR"p7&t^g=ǝn/V% o|2[-&f\NI4 Ш5 ڙ@lLx t h*+]_lN1-dnzFS=M;O-mnQm;\:W`h(;@z zw|_ r^eZ+G}kXfH(VH&BN<b87{;ۻiH|JkaAJwȔrE}s'ZGHtLZEJHy]W>=sVoG +q6gHVBtGDVފncA[!g&Y[ޢ;ǥLۭp \~NϞWoeY^&OԐH1?c( ;<ΟA e󎗦缌KF r~]aD֣hd ?>|.[cryFIrsq;ˡԊ*Y9ԁWȘW b1=OjJ|韕-0 ҪDO,qxEdeQܞߎ}6Ѽ ͒~YE|6Rb,lmKss^tԼO*Y+MU_qzŽ\HE@&r,[ff-Kz6Ky{t-M]fm$m kf)'@F23oq>c_qpNU瘹*cc^½6El_<]gdHZEi@A?I'˛1ӏˏ?o!*\w1*+R G ӦD2*£*v>Y!^?ݪz)ϣ~^Wz%#*,gZpǂ;ww6K!7;_:}S]м;imMpb~仩|׫yGqfaKu;m0#cH~\,]" *T13Ay r[jM{ò?3EA/̹2|{4ʳAm3l(~b9<v=||~д ++6U \:p"r |J (M;N\3.X VAAƻ$߲M&ziLT-vtnc9rvޯ} 8lìlvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWd:g{&F#Vu5gPVC{ϗΜMF8]_[I @ޔBb yIu Mx/yYy5+MV'>P}O##Z/TO>1tonVVI% ǨAV9m.CK+ej f5gnIsŇW39_?'ͭH3-uibV$Q;ds_|mܑ-CX'%0Sn߽#$nIJ%d{3-#^^e CYIlG krȜ\MFؐOhrea&wAn%hRv9+bV|#/ 9JPxPt$/#MP%XӋֻ- j;:_Of-o4 `/P)Zr Q e([RwuY$"fVDIeH9o6[ՆM+m>n(+T_:Q=Vxg>ѿ< {+fI}Z*I̍ikdem EAR  3 𞠼>iZk*$RbdجYH#p~xp44 Sp %p-G$5٘ ґ}ABzᮌA./x߽` v97]2/qےBEw=Ndjb٤UD=Ob P+rZ,F%#!R=F:(7/yϗR֝s} ?49dO$mSSmf_+G86vD-ЩR; 'qVvX_.tyNZVWVMnmzҞ5nIMMӤa4bz0uD>.L7rQ,| FqpuAFWiJˀ?4<75+s,UF[TWʫ0يTtZP9$p3_ʛ/ᷓ^EA4ꦥCNDվV3WZLYE YҩI ޽rɐvvpCUGhZ>™>r+h4gyBѾ0GRIZuFoس|9 9ǨMk:TCY0.}׶oϡߖA9t.w5TP)ȎG} wίϟ͏ͫN`i16혓#k;3R@i%3┏'o1jq-PDBx= zQ#DgR赡ʲK#~mgqjVSOSO_}/}.GS r'<%ed Z7w`5~$jhק1 ;HuB‹ҤGoLf%X*M5:'h;,Xnvm)-V9` ON8c,H ʄ_1b]VwZxfAFuH@ӳ_`k"5sK[MZ)۪fZ0!f9GNAG#wmJn<8hgo_-k0I Wi4Q'ML6z>*nʹߴ;!ǏH}wM|5=AC]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWb770$QFG`If4Ndvxcs+JE+?ҼbqAcWv3]gd4 [0kz|N%$.T|!j=o *IȋsIU>ab÷]&l)˟7禣9++0\$$2pfVMO]5=Y 鹨bXRMba%هp) 'Ď_T3#0wpn{xf{`|w]P}A}8!TDQ=9m\? k`B Qlu贿,#jZj-I 9%{Y44_VMiSө1n-ߚ7_ZɁv1z: JUm/oɾV99Jݼs_MDc"NEy}C 3}:i{/ĽoI[.f.Q|-zW|>࠘0%yo=WXؼ~(+`O*@h-'zƘ\.$GI'QV#l-.z`!lKPQ'qFv5;6;$'ْEWuۊaEz7/$#-GB Pa򎼲z6 a+1nvƄ crb*ZK_CB)y\W~bWS"X6չ1a=7&:S_/hL+ \I,єVJ';{]Ow!I ZS`<0!p4kZڂ#j386d7!БZ}E61; *drqo&ɐJ%1ʮ;bi9NCGݜ I]4]֓,Kމ*vJqp=fHf 2^kÆc @:^ySKo˘ 65.G4J( 28j܊3o= E*KW#Y ߘy^9)=ſVxb (x)FF~tOW:zzid1X)'rJLK(u?3\0=H4Y/±%*ؚao卯5 Q Tr<6I_a -=y7~rJ曫jm&vY@Œ`"`}ARy=HIh1mQ-F8TZo;^d[1L5 ND2Ҽ9j oN,ԨϗAQ]ˋ}9.t@?wSjoАNCIW0u ~y"A3AK3&fȌ 6]J$U<3BG&Uԩ&:sr+?hեFpEOJnEtYGE?PN]xH:_ࠃ=`~[t붻N Z@T=Mř~?d{+o-KP!+ @PFvZj=Èym]M+\@{ mֺc lo1~Iyk{Ƽ=(GLE"塉;sk>(2m+OUFM6)dP†q~w,?.ZeVAfMB=hw_Cr^d[̽f0+m `T|L meU+R VY)GZlq;4=Fg$K% RB)^mɠX؅ 6jEJztfv"6~[ͨ_ɩq9s4'<1Lj<g|x-Z,6ƴYp;2,?yQ/[gW,{׭;2XlV0[M@5#9vyX}:S jJumjrEZ95$t G2jCus#>1Xz E7=z-\GS{fn`KeKG쮤9{焿0*MwE*ܚ1UcRmſǯHuOx9E !yD % w<-*-Jr qڥ w$Sr/'vzlC" 2'~|iM tkKhf6H svgDbG+A؟0i`ߘcIg#9j2~\!꼕ĚϢ_}7M^Ob^}Yw=G2GΞr{voL?ɿk:a'1B촐)oZvfQ{9Qy J8rY՚_$[s^$%Z]AH_" p+d|6̼9L $ u{&x-*A'q_4~\[ Jݏћ|C+?ɿ˝WW6^eRcTh:Ҝ|MK37ly̌9QyRY!u(ޤsg]s_3}U¤>e@vg5ښ_GorMTcr/X_h4_KhQMݼ mc'TSGp @H*{;gA"=ros 4,QЫ)z\ CG\(V R(7۶N!+ޕev6[h7Ws,kîQ}$4'cQ$;ߖwWr<j iZr3ߋxߦ3c}{c,E>Ҡu$V5|J׷. {K.-ZNxdUtIDG*KFkQ31˄'7-9TgdnHxqkuj|pEvgZ֛_N!l|ywSJ.>,$R'SCy|~\kJE>IR6$PW)pnY6z0&eEX@5䥷J?5? byɚEΞw2FbBƥR*j)؋2 ]\jV>ZiFrX&O*׮x?xKnlix8&WmXkC-=ꏭǿv#oGgk.zϺE4cC,w|FZJ}+ny/x/k{54|wUE`3g0.͊6*ثb͊6*ثb͊6*ثN(ܞҍVI4,qƥ݂ܒN^< @T՘A`s; Vx0#N.Ͼ*S"CN!Pnn{Y3"=?KLz|9ߌY'k@"ZT֌lC--Y&r2*õOALd~vcU(VYH۹F9o/]NOZ{eB|%?.QflCkb9cSaO^r^ و .}Oͭ˞]oZhQE|9'zB=6_oTi(7ˉ[?46RxB#Wb[`;ᤒU©:<6Kǭc) * j7~vd4nAGzPkҽ}5/mUOuqY[.uqh?˗3@L lU@4aZl~yd")0Hߚƴ ]s$&ygn,2( hAo}4_`?hv"q 4qb1 ԚUNum'P1AA4]~Y 9~{QQ#7 Ee74߮NrPtX$i Յ(k@TQPE)D$nʛjmPX[W1Z{!4UWR j޴$ ܵiJWӕ ]"j Vw9A٘ïdG!>ZীҊoP\[j% P@vz\4gdە* Db;{;!V"k Cmt%zm_}SݮMhrUPU]%vD4 VN)-SI?YVeBUv<v]X/i[!:1;/3']٨l_ ޮ=)X@l}eYpmÐ$iu$}jB-Bh˾P N:wF U ^a1+P235 ;>/.v4iҾ92m2E@٠ԏ \ݤmBi^ιYt}{Ap;Fۊ\-SHMJ h woD>c!T&:rݗz #:ͣIIk HϘbF#,!i-Z|U?~C5;wrҿ HIb +B%4}B94zmtI^U ƜJœfןqh׎rJ4oOu^T4;ס%oXCӋPR`fgđXa]TҞM-6fxÓ0)|KʻrQ;HC[leΝ$su+e~#B+חT܁t^JQڃ4hy1|sg~g\nif'fw&5&uK=.Oӂ im%Q,ow8)WZ㇚Bt܂S7SnʼԵ"x `n\텈r?,jZKqsx:,NWFIu~A ʔPRMFvdFElJn@@Gzܰ|)De+$(z`).XwZnO_׍ 2[M6U(R aNyrLu)m0O-iqq,.Ec*֫˂Iz@*Y3W,q=?+?#s2PI G)=rjOV9'}A[oHmӣ3E^~NN=/Y|͚ic<^hn--<~s9 r90{2NLԒZƸ(TvANM6޵2i>QԵ"ȱE<@5 Q]9Pr7~T7WHB!+|(I,FM=y5 bKM&Tl];l٭y󙑧g5ߚq>Cݭ) HjDh*~GNv[{tJ@>A^{\fn\,Q5UۓS-<0LP1w4TBrʻOڭ{)|"{' `oGTvBmtHęI4SFV5; mn#l_y>w)>@TeIivڄ<>K[WWcU;Tr|E f PbjRsPiMb\(` ^~ 6kG{l?1<ͨsC$ÈF$d}jW5o9lgl9fS㒰]SU8>`s͉gQĊ0or UA+A78[qrN€v&r Zt+ &† lʇC)K YR(Bs5f8ȆoVt%†kSBOC,cVi#pLS>'ўYeEev[PaʿHSӳf&!_`i_qz"3H'? |ۥ~s?[Ԗѧa_pܙjKEN^"ݜLs9"`:JFMeل:S Zp G\ &+z_|uYQ]M )ƙ ^ *(Ho|3.DYy[ FOUAy Aބt녗NKA](i٦Z}#* P~UȌ0yHX$?p̀,8dVzh/Z88Kolj4ǶfZ׮RE:F mG2(5MXP-jo kS z=i}fg!OdcҪQ_ZmcC<\#VJHv8REvS\֗'9.!K4Ȫ*cm=;uXm6ByAd.omo#G1${;AmJg$5WOr3(ڊI}֍O|fH%o?˝7?fY[i r2< AAJ%$PI'=? #4sX4,4b!5K'8mpTT ;XC@ "2` ȓڹ\bn8 6R_ݼ ~_b7t%0lhtdnELPPnM3$Sq r˩[I ?  yi_өH`>qa<[8 zx5b_K<c@vȁH`żDv>^$I*U'-P֛fJwv 4VE v,6^"C8ʝ+/d(8ЁCOjH#kH$:]ֲG5%H`"i(ҵe!GG#Su_=+ʟu#l~'-W/vlUٱWf]vQ!w&n,2x` p",ڮa[{}%H]tzv#ߒK7ka@W>SYڕJOkzl@ai]n{HZڦ)@5E ^t/s¿_޽Ŭ#61R@H#Z  |ۯM+Mд-?Lڷr($Bh\'Z_K/3(K$PI͌^F(ܖr,̚O,Ow^hRjJ P"NIpWH?Ⱥ-Vai=Ó@# ҃?Bz_4 y{Lc@7ff5,zs[\F.̽cϺߝDqx{#J6$sʭ@c#i;kTDwmnMTWAy,Mʧ!3c$|O-*Q?eاCWt: ƙ]r/-];$ zQV4G M~ ew"I!Xh24cp(v+WcmZ > 4eO%jv3Kh W1G>`Հ4+VO 8[?RziJvM-e6LTtV7ߦtV"_Ծz&+S?b4mg4S81TT#Wz4M-gvG$4W/L㒓/R,G:,`΄AO9-oWN~;ij@ʌHqćV<n9TFv+`2 M b7p^'j@1eK#jwFoGK3ՙ rݘt=;\"ii6{oyseP W(?=A2/gNQ9*!Hw?lʨ@"eFKͩ J6pO$(z]}آBT^ՠĥ = ߔs<ȩ*«ZA q@Clh6d'jPiCijH,~9)X⤑V@^T+nxL`r+QZއ)̝x>"g?#U䴦~x&a zj(v""j\) q3Z2TsVGتv0WufG ]#Yw&OCӬSh(兞2QY^9?<4]) {"!As_Ֆmnȿ~m^?Z㉩#%I'T)?-kZ.Yo20ҽ6X" :_ߎ.WkU~kkPRjK( =^2l;$Qa^2B"S_e.BC*<էL6̆9?#znx-GR+y Hmh%Mw A>m.2Hc݃(,бwۨ9\ **gKe FZE|7[I^,BW5S&A%G+h/% JBFN%YBbАw\^Xѷԭ-? P؏j*Ol9-/Oėek4ıe d/N@BǿrS'bq = B$Wj~|/._˝VM4h4UjUd!S _n[EgpBcQG=CKr\DP~<\\Ky,ܞBY-d]RR+BA?30BˍTXĆ@",Z6C9&:rLzgʠ]A/J{7QN7JҞBk rRqR}d~[PQe@eoAӃ$9?Ѿ̔5&ҙ}2gvnpk$jp5ޛmnI SZ0(U:N&]Nڂq4"9Y ZIY ~-B{|F7&@;{h; ~!Yד4QOpZF *@^Z *zWm.? XTq$Gۖw^Zxf@27$f!-7$yehfݛa_Ǿ@/9&[zo3ŀER^i@9l@mr5HcB6ʹcaޟgR:*MpKz:| t QfjPW%q4ŀ LoIrom i8'= {za/CPFa@ #V(*GL.򄳾w5TI"@ ވB,.QdodlSlH_T*"V BYcY4.;MIHj S g%7+6 ׵ũOxrۑВX{j‘+qf?*22>KT)Nejx0o Ëvʓ Kzm 5 #͏ͦ4J|LG\^xJ\% cQ{JuѪL[ *M7*)P;"_#$Q◆&?0\y^ jGԣ:N+[BBVPXzU}>\#Wu0Mjs]q,N+ejM#Jxܲ $'c <"q_v7>\ִY-uN9ZCT;=|Ip@B(X*Ji\#FZET5톚Mb񖒀Iu;z`(vol8cQ煅S#JQ+Ԟ Iߑ="݆j^ ©"5 lv G-G4m";쵉@*qҽ4mQd5L=VHmˡ A ?pҤIQ boCnԸSaDmdy1+!Mw!Tkh=hb%k;#xUMO٧v^MiÑ#J^I+O~hճ[`c205E{g1^xci?ܐGƏ&(<}syKͺ:mR㻼 K~@Aڔ9D$;r$1l8_[fbV[ >eVQ$kZWc۸iXkNzt/O1?Y|_O(e攱4uӗӐ14u[iȐƵe]{? zcyp£EҴgjnǮ:R.zZ;شs$0Gq-LDB@,hzj\i*ģjZSZ\rdm蚍#rRD_Uk ̖zo;hn\xFC0ĸڈđ~qywvJi-^ա*Q*ֿ˟Bu}EMߠ Mivu"=_IˣJKyR"f@J1j€zx]̓\{.T`{$zNR$_0ޕ˜=JCqWj.T 6tt e`KQx`~%'^Ek paB~/q_!.\ kJblKzՑee vVoӫ{~9%1;ƥi,жp7(U0 =ֽHܚv͘bO6ʡ^ᐆ*^J;r?*aw<6wC<ؽߪJ8~{xt6[}6 SN 4r?G-J.B=Sb^^pzQԌ'$m}ᦏJSG)C7zߩ__Ge1d6eQPd2֠GYĹ=OfN\k}9O,l Dۣ;lb 1$MvI9,A8-ս)Udx}:UPPPy+GlFTfO7Yd?,zcUOd; ):_XƮFs2Tk"Yﭜc hz~YO(CSsؽCoUe/Qjf"P.C dZPP M==Z;B/srq+QW,~$LF]ՕB?{qEUYV4D;^<(a_+'c!*!j***?g"~`n覙9D#}`krnj>zoo#NYu=N-YK%w":EQO]J47vO WcImw;d3Ybߵ)nt,JJȠSӽ{g4TCSuxIu2/HҬi'ٯC,ҍ:F}ٴ&ehmc`^:W`5 §a &=Bѹ%Vܚ 6xXU8BkڙAkP$.LPrܺ^ 9jDz)EPdO +u5sIYHI#oлbw$to1*ni31AIeLHh7aõvK?8~g@oWE-sRj5>yY۱D>+bi.ݭ?SCII\GuV~y'C6d,*73GF8^՜Zlt83?BA%mhI%i's@mӾ]cfC]ڊH,<v1an i <;K8 hO5QE7O.J+O?rOUV+Ulzwk?G u,ᐖ(M]$!"҇nbHAڴpɣ2nUV2T3.nd$zmlcEzMUeVMC~,*:oC~4ڿNO2ezST$+?t()ОpPԢ~&TJ =g.\؊SSy-*($. &)BTm7G8%-tP҅پzяpj) V/\GH|a9]yUU]cҒ:-vt Ww=6(7XlS )ź# s3M; OK&H`CɚxysU`B:(oybfIJ6P@kCFC~Э Aysr!__Mic.b786W ]~fHZsӍ\26p_1Pv@^d#r 'rjsrRFfT}P=c-=]?+#KKO[Cd o:2?ֺ mͣYy;jY g(_7~Kh8$q4j?Nr>QI<\и]mS*cg^iVZ$vB(Z>x-6DY2굍vv -z.0\~QD1<ޛ~ ;7Ϧ\C0i򔸸oIJױ]W9NA9Y?:0_&att㷶Wщ$gM!*z{ Obz&EVeksT}䃓0 Ol+`DY(J' Y=ԀM*z9a5@RC4?TFuc+\pő~_5{)',JT0܇cWԷ"5HE c)lœ>{vsyݵA4$r<>3jwq,P f؊C^M|3d-~8 6?u*EF4"D8dk]vi'i9E469+uv2+*Mv!cPl*¢Q`1;(_ƴ*`m`׵ )@Cxl%&;Ȓ9f1Cq>݇zn&3BC.~0R~ʥlZ"#_1I;Db`FÏmn/|C,G*mֿ*!@@%$Xku*wJ7|2H@Ŕ49'o;2[gB^xZ%Bq, U{_o:cvF!3J|$ b~(c]-Nع8y䁭)@NlT40ڽi)ẗ-97 (8A9$TÑ;T2cOKiqX+Q]jMBk-淍ҠB+ˎ)B;,^UΏqjVzsX BJ%S⨥1k-%掇HԢ]Nn+5N6Hm<&)WӸf*K nKUM0J3pg갗%V`XVI燾PwEi\Ƀȩقyq Jd#ː+\^dA0nT7 V=02r,П[*e_mIRU\LMzErXiǨ=F#wDoˏ4YW>BՈ5*#Y.w%!DܲջPTrl&oa<~g姖z" c ;; tc!ZA/&="7peӦ=+Li8߬Z>@H*a~=9 畈Ӝ|yƯ92ZHQph+L9ȯАߚ7Ngiո!̤`ضb (uaUSJ\y[+ϖWL~!,9nE3!`ӿ9|8[Y%Ο[eޡ>"CQ@ j)G<Ȍk鑬jrwf Nf GjW*YM%kEj5sǹ4?X+04oFTe` YSaq/^DMv'45&g"ATTӎ2ȺNƱ5"\$1CZ@чKo-y[}+c&F-J)F"sɱV#h O$IA}ֿ̩Z[];2xQʺEϥyw%ՒePI++`9p0~L/4d,wizi}R=߸q>'O ki _0- !xk/#L,}:$Nd֬Taŀ>ٍ9xC~O)s4S:OFmuz8%wC g֏#~Dy:)?HyR%Qn""rβA}4v[+X ޣȦ{1},\$rT Brrr1jG m't6+#*(Ŕj:?)Y|哮yQD$̃p y9$9?#4 ;KϖVG]V-fsͣ@&ΏQCũ..өcXJTb6뜣̞bdN45 gWJ@}.N7z%Oy '{;y[ND@ v尮ns}Q8g2=ƒ+UxxĮƻ]ߞbUdFTЊ{{Sp. 8@n uB@F$C^J0z/0OQUMۖzd(27fDl+7N%9n;n&hûJT|$TGO!)38GjN8$ZZ?Z6^E*  y7/aak_cѵ{ѭۢ̉]BMOnyi*$½*kjTCz/ X>W-'{RՔls| ~,,a0oʫJMzvK'")NYqV#Eʻ3m 0h*yP9ԇj[3I:]R2*eƝOKeZdI[+)YhH€O צ6m (kJ|7~k5:sӌAT ȱzW}Ҽo#qkMfT*u;{{hFY1㸦kZ97/u#ɚroiFJFIeP7Jf[ҟ>MC2uHӇOzuȊ^EBn;zզi ^s+ŹyoϚB Q,ҿ&G P]OS^U?-U#aM8"E?F XOl晔yK8IEش=; 89;55imiFК&4% {䰈 a-O :cy gI~p\F@A)BB oר_]5K 'j3&y[IAX (ùԼh^裩_R>z m ީ/\L!oH4?C0G^o?:PcJMVAZ( $Ǭi~Xֵm-"fYR5]<>􏗿Vg ZWJ-66Ɍr>^y1ds/_Xt/|4e4kqM&܂|}7.GQz={u#sq'bK9|~D~_4=X$jRr]q8qjF y3p}J`&P˒},ѿ>55xOpUq~IPPz(A^s!%@qu> s^kߋR]/⺻Ź 2:$x8`M:ʆ1?"԰MG2),h`W Wf 3?ZQØnl*w14z}Ȝ9u9=MT ܬV}a#I>9r9]ҭST*HP?O,/n84&z*):iI6dD zRrV*9LW'EY.܅LLMhJg `&BU4xw1Kny8}]P8VѾatWI5S8`SB H'aݵGΔ`> ۗomNp &Hت Za[ m})%y)StZO|H%v]I+ woJ*-ɆN@f7'k˧NCd }06gS^@vg &*z2rd]"FxOeY )~~dj{| ͔Nrj >exݣ0q?z.OE~qJo} u“ŀحZ2AXr\$4r@AAR(zQ,>;xdh el(;+C"e؅SPH'zmHah;~O m0˕)(P*{0$UH]SOf 'e鶞).PrQ]zwۮB/A[RUg"HzVra%~y_yoWQc"R9@]ҫ#GQZR+9lՋ;Z.mIbD* hVp476&e+nҬ:V>٭:g?\Jv[[iu2Ѹܳ:l-nAHk3]{w)LzrC{|D%۹H#bH@BZJlw%G̛-:炪 UU}CPJFMjC1xFK& U=: %?&9{wә) [DWb C%Trsg4-C:q ӯ|kB8\٩HPޜyhxv9.|Y?Go}N>wӜ5%~ȊTQ6$_D_MH `G4REM( 6Ē*!Bl<76ޤ+EŠۿ}Qؼ͟?zچkyL-bN#V"IP\HtRnnQdz']=G?#>]of$EɣOG7GETԦ9#)%ƥɫkֻg8vsaa:HL/3ۯ#ӽsmqOu w}u?9Zd{e.dUj=Ix9c1!c1m# gYyna#bҳazpe>O{gX\VYod"Ԛ8SH4zb6Vj)r @}und|ɬ+ fghفZ&9?+/MGPf젋u`>Đ{U{wh>*f_+jSM[ȝԥV'dEOo]"Hۘ"CECo2C@>w/S+nLҗB\nd{NJ8j.dԚ;Mv^lIn(m@S剴8@]/T/ .uJ3',ɴ[59}9`Bc8̝h/ڀ|=o2 6?,χgGYӨ| ;ԏzR3fH7 0YP |_F掝qK)oU7RG9rŝ>o㎷kyPli:wc&QK8%䦛1i %f(+Zum@q趷Xd.dIģ75*h:g#4-v5jis! @O%!90$Sֿu0m!E}2ه w7>هDi|KWƅv[mjIl#D ,V,*i5ҹ͚͋w:P]g?%lE婼i}/5ZV(5hbA@!dvlٳ]EиxPáT@wn-fk{)vHQЕe :A }32;4eh\ȂYWz{`P|DWg>ǧibHe;E$mǹs"M,l<ݭ^LԵϢYz ^|-ˏo4V29nFF 6`@˰˼|x|G=w^%O ۚ#U*#JiT >N`A*G| FR߶]W90_ئRKInaIZ)`sFს=AُNmw9'_ m_=f޴ҨJ?Lݝc2C??>qo譴b|IĬNGT'ӨاG8iڮ}at9=+QQq%)PvPKyrInkGg/+~[gFvAk< H.w{ 4p ZHw9 9uϹ